SubtiBank SubtiBank
ywqJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywqJ

putative toxin
locus
BSU_36190
pI
5.91
mw
66.51 kDa
protein length
602 aa Sequence Blast
gene length
1809 bp Sequence Blast
function
unknown
product
putative toxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    3,725,600 3,727,408

    The protein

    [SW|Domains]

  • [SW|LXG domain] (aa 1-235) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|2401A4E3E5E683472C51AB2F31BC4F54F672F32A|ywqH]-[gene|04376B3166B591132CE37D1DE85B0ECFEC6902EF|ywqI]-[gene|2F9C623DDF9F93EFD46F024FDA3AF2A92FC9BF7A|ywqJ]-[gene|7ED407717C216FCB2B281A3ECFAA2ED594F021AF|ywqK]-[gene|F2C6956D69FBE57933E46136436E8E80B63DF8BB|ywqL]
    description
    [Pubmed|22383849]

    regulation

  • expressed throughout growth and staionary phase [Pubmed|22056936]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A576 (ywqJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/576 NBRP B. subtilis, Japan]
  • BKE36190 ([gene|2F9C623DDF9F93EFD46F024FDA3AF2A92FC9BF7A|ywqJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATCGCACTGCCCTTTC, downstream forward: _UP4_AATTATATACCGGAGGCTTT
  • BKK36190 ([gene|2F9C623DDF9F93EFD46F024FDA3AF2A92FC9BF7A|ywqJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATCGCACTGCCCTTTC, downstream forward: _UP4_AATTATATACCGGAGGCTTT
  • References

  • 21630458,22200572,22383849