SubtiBank SubtiBank
ywqJ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ywqJ

putative toxin
locus
BSU_36190
pI
5.91
mw
66.51 kDa
protein length
602 aa Sequence Blast
gene length
1809 bp Sequence Blast
function
unknown
product
putative toxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    3,725,600 3,727,408

    The protein

    [SW|Domains]

  • [SW|LXG domain] (aa 1-235) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|2401A4E3E5E683472C51AB2F31BC4F54F672F32A|ywqH]-[gene|04376B3166B591132CE37D1DE85B0ECFEC6902EF|ywqI]-[gene|2F9C623DDF9F93EFD46F024FDA3AF2A92FC9BF7A|ywqJ]-[gene|7ED407717C216FCB2B281A3ECFAA2ED594F021AF|ywqK]-[gene|F2C6956D69FBE57933E46136436E8E80B63DF8BB|ywqL]
    description
    [Pubmed|22383849]

    regulation

  • expressed throughout growth and staionary phase [Pubmed|22056936]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A576 (ywqJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/576 NBRP B. subtilis, Japan]
  • BKE36190 ([gene|2F9C623DDF9F93EFD46F024FDA3AF2A92FC9BF7A|ywqJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATCGCACTGCCCTTTC, downstream forward: _UP4_AATTATATACCGGAGGCTTT
  • BKK36190 ([gene|2F9C623DDF9F93EFD46F024FDA3AF2A92FC9BF7A|ywqJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATCGCACTGCCCTTTC, downstream forward: _UP4_AATTATATACCGGAGGCTTT
  • References

  • 21630458,22200572,22383849