SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


putative toxin
66.51 kDa
protein length
602 aa Sequence Blast
gene length
1809 bp Sequence Blast
putative toxin

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    3,725,600 3,727,408

    Expression and Regulation




  • expressed throughout growth and staionary phase [Pubmed|22056936]
  • view in new tab

    Biological materials


  • MGNA-A576 (ywqJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36190 ([gene|2F9C623DDF9F93EFD46F024FDA3AF2A92FC9BF7A|ywqJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATCGCACTGCCCTTTC, downstream forward: _UP4_AATTATATACCGGAGGCTTT
  • BKK36190 ([gene|2F9C623DDF9F93EFD46F024FDA3AF2A92FC9BF7A|ywqJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATCGCACTGCCCTTTC, downstream forward: _UP4_AATTATATACCGGAGGCTTT
  • References

  • 21630458,22200572,22383849