SubtiBank SubtiBank
fluC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

fluC

flouride exporter (together with [protein|BD1C4D9E6E8960DF77EE1571A637929C2D8C4A28|YhdV])
locus
BSU_09600
pI
9.85
mw
12.31 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast
function
export of flouride
product
flouride channel
essential
no
synonyms
yhdU,crcBA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.11|Other exporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,036,953 1,037,309

    Phenotypes of a mutant

  • very sensitive to flouride [pubmed|30430725]
  • The protein

    Protein family

  • CrcB (TC 9.B.71) family, (together with [protein|BD1C4D9E6E8960DF77EE1571A637929C2D8C4A28|YhdV], according to UniProt)
  • Paralogous protein(s)

  • [protein|BD1C4D9E6E8960DF77EE1571A637929C2D8C4A28|YhdV]
  • Structure

  • [PDB|5A40] (from Bordetella pertussis, 41% identity, aa 7 ... 87) [pubmed|26344196]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|04CACAF4F786090AB67D7C606C944F07B7A7FE55|yhdW]-[gene|BD1C4D9E6E8960DF77EE1571A637929C2D8C4A28|yhdV]-[gene|2F86A2FF36ED00DB0A9A91B064EBD095F5E759ED|fluC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B486 (yhdU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1485 NBRP B. subtilis, Japan]
  • BKE09600 ([gene|2F86A2FF36ED00DB0A9A91B064EBD095F5E759ED|fluC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTATGAAAATACCCGCTA, downstream forward: _UP4_ATCACAATATAAAAAAACCT
  • BKK09600 ([gene|2F86A2FF36ED00DB0A9A91B064EBD095F5E759ED|fluC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTATGAAAATACCCGCTA, downstream forward: _UP4_ATCACAATATAAAAAAACCT
  • References

    Reviews

  • 28514705
  • Research papers

  • 26344196,23991286,30430725