SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


flouride exporter (together with [protein|BD1C4D9E6E8960DF77EE1571A637929C2D8C4A28|YhdV])
12.31 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast
export of flouride
flouride channel

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other exporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,036,953 1,037,309

    Phenotypes of a mutant

  • very sensitive to flouride [pubmed|30430725]
  • The protein

    Protein family

  • CrcB (TC 9.B.71) family, (together with [protein|BD1C4D9E6E8960DF77EE1571A637929C2D8C4A28|YhdV], according to UniProt)
  • Paralogous protein(s)

  • [protein|BD1C4D9E6E8960DF77EE1571A637929C2D8C4A28|YhdV]
  • Structure

  • [PDB|5A40] (from Bordetella pertussis, 41% identity, aa 7 ... 87) [pubmed|26344196]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B486 (yhdU::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09600 ([gene|2F86A2FF36ED00DB0A9A91B064EBD095F5E759ED|fluC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTATGAAAATACCCGCTA, downstream forward: _UP4_ATCACAATATAAAAAAACCT
  • BKK09600 ([gene|2F86A2FF36ED00DB0A9A91B064EBD095F5E759ED|fluC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTATGAAAATACCCGCTA, downstream forward: _UP4_ATCACAATATAAAAAAACCT
  • References


  • 28514705
  • Research papers

  • 26344196,23991286,30430725