SubtiBank SubtiBank
ntdA [2019-07-31 08:07:23]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ntdA [2019-07-31 08:07:23]

pyridoxal phosphate-dependent 3-oxo-glucose-6-phosphate:glutamate aminotransferase
49.98 kDa
protein length
441 aa Sequence Blast
gene length
1326 bp Sequence Blast
synthesis of the antibiotic kanosamine
pyridoxal phosphate-dependent

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    1,128,286 1,129,611

    The protein

    Catalyzed reaction/ biological activity

  • 3-oxo-d-glucose-6-phosphate + glutamate - kanosamine-6-phosphate [Pubmed|23586652]
  • Protein family

  • DegT/DnrJ/EryC1 family (with [protein|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|EpsN] and [protein|38DBA751456A0C0EC5D028939ADB8860ADA28F94|SpsC], according to UniProt)
  • [SW|Cofactors]

  • pyridoxalphosphate [Pubmed|23586652]
  • Structure

  • [PDB|4K2I] [Pubmed|24097983]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14612444], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|NtdR]: positive regulation, in [regulon|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|NtdR regulon]
  • regulation

  • induced by 3,3'-neotrehalosadiamine ([protein|search|NtdR]) [Pubmed|14612444]
  • view in new tab

    Biological materials


  • MGNA-A725 (yhjL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10550 ([gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAACAGTACCTCCAATG, downstream forward: _UP4_TTTCATGTTATTAAGCAAGA
  • BKK10550 ([gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAACAGTACCTCCAATG, downstream forward: _UP4_TTTCATGTTATTAAGCAAGA
  • References


  • 21512256
  • Original publications

  • 19087206,19342798,17056753,14612444,23586652,24097983