SubtiBank SubtiBank
yjlB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjlB

unknown
locus
BSU_12270
pI
7.45
mw
18.19 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,297,726 1,298,223

    Expression and Regulation

    Operons

    genes
    [gene|2F5683B654BD1B7FA4D55011CCE6413C38DB3F4D|yjlB]-[gene|8279630BE1D1D214162BA8E06FC05146F9ED517D|yjlC]-[gene|56F407D408272F3674612C9CDFE4A922680EC694|ndh]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A360 (yjlB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/360 NBRP B. subtilis, Japan]
  • BKE12270 ([gene|2F5683B654BD1B7FA4D55011CCE6413C38DB3F4D|yjlB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTTCACCTCCCTTT, downstream forward: _UP4_TGAAGGGGAGAAATTGCTGG
  • BKK12270 ([gene|2F5683B654BD1B7FA4D55011CCE6413C38DB3F4D|yjlB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTTCACCTCCCTTT, downstream forward: _UP4_TGAAGGGGAGAAATTGCTGG
  • References

  • 26577401