SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


18.19 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,297,726 1,298,223

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A360 (yjlB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12270 ([gene|2F5683B654BD1B7FA4D55011CCE6413C38DB3F4D|yjlB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTTCACCTCCCTTT, downstream forward: _UP4_TGAAGGGGAGAAATTGCTGG
  • BKK12270 ([gene|2F5683B654BD1B7FA4D55011CCE6413C38DB3F4D|yjlB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTTCACCTCCCTTT, downstream forward: _UP4_TGAAGGGGAGAAATTGCTGG
  • References

  • 26577401