SubtiBank SubtiBank
map
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

map

methionine aminopeptidase
locus
BSU01380
pI
6.39
mw
27.26 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast
function
removal of N-terminal methionine from nascent proteins
product
methionine aminopeptidase
essential
no
ec
3.4.11.18
synonyms
mapA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.1|Protein maturation]
  • Gene

    Coordinates
    146,527 147,273

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • Release of N-terminal amino acids, preferentially methionine, from peptides and arylamides (according to Swiss-Prot)
  • Protein family

  • peptidase M24A family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|YflG]
  • Structure

  • [PDB|2MAT] (from ''Escherichia coli'', 46% identity, 65% similarity) [Pubmed|10387007]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|BEACD74FE0AE56E8154F3EB8D4247488030BF0D3|rplO]-[gene|5350DC618130E013757EE667B9AFC5F2EC68EC08|secY]-[gene|DD3A39A84E53A9B2ACBDD89DFAE3560E45C08DC1|adk]-[gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9371452] (two promoters, about 140bp and 200bp upstream of the start codon), in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • additional information

  • strongly expressed
  • view in new tab

    genes
    [gene|751D0B909922D4D931FF3B2285CF142D966FCD48|rpsJ]-[gene|FEF94BD8482A41C493A8BEC3278B518E8BB4EDFE|rplC]-[gene|02F0893E814E00187D7B342990838EE5445CA78B|rplD]-[gene|5F3933197343FBBDCBD42B408837F8EEF0A0BEBD|rplW]-[gene|9445AC486A2B0A025030B275C789D227D5694145|rplB]-[gene|5287063586EB218843451386108E45274C7A8D68|rpsS]-[gene|F3DE42C41EF57DC5DFFF0D28129F2CE5DB781D99|rplV]-[gene|E7F4E01A6005C8469EAC64E8DFED96D0F29791A9|rpsC]-[gene|C5CAED1256F082E722EBA0A72647AA043B5681DB|rplP]-[gene|49B6E673E28CF21DF629B90A6AD453C46822BDB0|rpmC]-[gene|657A76B7786DC44861ECAC8FDFC8B4E8B55EF05F|rpsQ]-[gene|2BE91EEB70A1961D3BBE0603648E64E86CD0B708|rplN]-[gene|7E4159B8999B33370B12C18AFE2455507DEF891C|rplX]-[gene|F34C72BF4C3A8FF710D3B65F87324400ECDE3610|rplE]-[gene|0CC562884650F322298BEA28C889E2ABCB01AFDE|rpsN]-[gene|B50A96DCD3E8FB26BBC2819DA11A6E0B040C1C8E|rpsH]-[gene|20485A785D3AF82889F2018D3EA5B5FA33E64E95|rplF]-[gene|B39056862596254F3EC7AB2466B6FB3634621DF0|rplR]-[gene|144D952B05EBBFF41EC92DF906543EA00475FE69|rpsE]-[gene|87741B91E3081B7CC1C8AF275B38A52C066F018C|rpmD]-[gene|BEACD74FE0AE56E8154F3EB8D4247488030BF0D3|rplO]-[gene|5350DC618130E013757EE667B9AFC5F2EC68EC08|secY]-[gene|DD3A39A84E53A9B2ACBDD89DFAE3560E45C08DC1|adk]-[gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]-[gene|15EAA4007484D9F82CF4F402FF156165156FDDDE|ybzG]-[gene|BFAF497FB8E871AA84A0864CB08D2059791C7E73|infA]-[gene|F69B475C014087C6DEBE2F50F91862A623D21D1E|rpmJ]-[gene|C8B2EC9E35BDE4FC9B5642B8169F4BD13ACD30AC|rpsM]-[gene|8F83D1839E63016E2FA599A756A161DA5476D4D1|rpsK]-[gene|8B9957188874E9A20D2490730BA216F813D48F36|S56]-[gene|5996A5C25E108A3C4562686BF34A59CB14FD56EB|rpoA]-[gene|0D210B61B8F58DA21D97CFDE441501E31AB50D00|rplQ]
    description
    [Pubmed|9371452]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9371452] (two promoters, about 140bp and 200bp upstream of the start codon), in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • likely autorepression of operon expression upon binding of excess of one ribosomal protein to the untranslated region of the mRNA [Pubmed|17616982]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element (protein-dependent leader) including an intrinsic transcription terminator upstream of ''rpsJ'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • BKE01380 ([gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCACGTGGGGTTTTACAGA, downstream forward: _UP4_TAGATGATGAAAATAATTCC
  • BKK01380 ([gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCACGTGGGGTTTTACAGA, downstream forward: _UP4_TAGATGATGAAAATAATTCC
  • References

  • 16207374,8635744,23770820,28189581