SubtiBank SubtiBank
map
The papers of the month are back! Check them out! Link here

map

methionine aminopeptidase
locus
BSU01380
pI
6.39
mw
27.26 kDa
protein length
248 aa Sequence Blast
gene length
744 bp Sequence Blast
function
removal of N-terminal methionine from nascent proteins
product
methionine aminopeptidase
essential
no
ec
3.4.11.18
synonyms
mapA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.1|Protein maturation]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    Coordinates
    146,527 → 147,273

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • Release of N-terminal amino acids, preferentially methionine, from peptides and arylamides (according to Swiss-Prot)
  • Protein family

  • peptidase M24A family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|YflG]
  • Structure

  • [PDB|2MAT] (from ''Escherichia coli'', 46% identity, 65% similarity) [Pubmed|10387007]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|BEACD74FE0AE56E8154F3EB8D4247488030BF0D3|rplO]-[gene|5350DC618130E013757EE667B9AFC5F2EC68EC08|secY]-[gene|DD3A39A84E53A9B2ACBDD89DFAE3560E45C08DC1|adk]-[gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9371452] (two promoters, about 140bp and 200bp upstream of the start codon), in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • additional information

  • strongly expressed
  • view in new tab

    genes
    [gene|751D0B909922D4D931FF3B2285CF142D966FCD48|rpsJ]-[gene|FEF94BD8482A41C493A8BEC3278B518E8BB4EDFE|rplC]-[gene|02F0893E814E00187D7B342990838EE5445CA78B|rplD]-[gene|5F3933197343FBBDCBD42B408837F8EEF0A0BEBD|rplW]-[gene|9445AC486A2B0A025030B275C789D227D5694145|rplB]-[gene|5287063586EB218843451386108E45274C7A8D68|rpsS]-[gene|F3DE42C41EF57DC5DFFF0D28129F2CE5DB781D99|rplV]-[gene|E7F4E01A6005C8469EAC64E8DFED96D0F29791A9|rpsC]-[gene|C5CAED1256F082E722EBA0A72647AA043B5681DB|rplP]-[gene|49B6E673E28CF21DF629B90A6AD453C46822BDB0|rpmC]-[gene|657A76B7786DC44861ECAC8FDFC8B4E8B55EF05F|rpsQ]-[gene|2BE91EEB70A1961D3BBE0603648E64E86CD0B708|rplN]-[gene|7E4159B8999B33370B12C18AFE2455507DEF891C|rplX]-[gene|F34C72BF4C3A8FF710D3B65F87324400ECDE3610|rplE]-[gene|0CC562884650F322298BEA28C889E2ABCB01AFDE|rpsN]-[gene|B50A96DCD3E8FB26BBC2819DA11A6E0B040C1C8E|rpsH]-[gene|20485A785D3AF82889F2018D3EA5B5FA33E64E95|rplF]-[gene|B39056862596254F3EC7AB2466B6FB3634621DF0|rplR]-[gene|144D952B05EBBFF41EC92DF906543EA00475FE69|rpsE]-[gene|87741B91E3081B7CC1C8AF275B38A52C066F018C|rpmD]-[gene|BEACD74FE0AE56E8154F3EB8D4247488030BF0D3|rplO]-[gene|5350DC618130E013757EE667B9AFC5F2EC68EC08|secY]-[gene|DD3A39A84E53A9B2ACBDD89DFAE3560E45C08DC1|adk]-[gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]-[gene|15EAA4007484D9F82CF4F402FF156165156FDDDE|ybzG]-[gene|BFAF497FB8E871AA84A0864CB08D2059791C7E73|infA]-[gene|F69B475C014087C6DEBE2F50F91862A623D21D1E|rpmJ]-[gene|C8B2EC9E35BDE4FC9B5642B8169F4BD13ACD30AC|rpsM]-[gene|8F83D1839E63016E2FA599A756A161DA5476D4D1|rpsK]-[gene|8B9957188874E9A20D2490730BA216F813D48F36|S56]-[gene|5996A5C25E108A3C4562686BF34A59CB14FD56EB|rpoA]-[gene|0D210B61B8F58DA21D97CFDE441501E31AB50D00|rplQ]
    description
    [Pubmed|9371452]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9371452] (two promoters, about 140bp and 200bp upstream of the start codon), in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element (protein-dependent leader) including an intrinsic transcription terminator upstream of ''rpsJ'' [Pubmed|27120414]
  • view in new tab

    Biological materials

    Mutant

  • BKE01380 (Δ[gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCACGTGGGGTTTTACAGA, downstream forward: _UP4_TAGATGATGAAAATAATTCC
  • BKK01380 (Δ[gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCACGTGGGGTTTTACAGA, downstream forward: _UP4_TAGATGATGAAAATAATTCC
  • References

  • 16207374,8635744,23770820,28189581