SubtiBank SubtiBank
lipA
The papers of the month are back! Check them out! Link here

lipA

lipoyl synthase, trigger enzyme
locus
BSU32330
pI
8.25
mw
33.77 kDa
protein length
298 aa Sequence Blast
gene length
894 bp Sequence Blast
function
synthesis of lipoic acid
product
lipoyl synthase,trigger enzyme
essential
no
ec
2.8.1.8
synonyms
yutB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.7|Biosynthesis of lipoic acid]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.5|Trigger enzymes that control transcription in a yet unknown way]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    Coordinates
    3,320,324 → 3,321,220

    Phenotypes of a mutant

  • reduced transformation efficiency [Pubmed|19028902]
  • strong inhibition of growth on minimal media [Pubmed|19820084]
  • The protein

    Catalyzed reaction/ biological activity

  • Protein N6-(octanoyl)lysine + 2 sulfur-(sulfur carrier) + 2 S-adenosyl-L-methionine + 2 reduced [2Fe-2S] ferredoxin = protein N6-(lipoyl)lysine + 2 (sulfur carrier) + 2 L-methionine + 2 5'-deoxyadenosine + 2 oxidized [2Fe-2S] ferredoxin (according to Swiss-Prot)
  • Triacylglycerol + H2O = diacylglycerol + a carboxylate (according to Swiss-Prot) required for ''[gene|788725411B2E741103603373E43441FD036E1BA0|comEA]'' transcription [Pubmed|19028902]
  • Protein family

  • Lipoyl synthase family (according to Swiss-Prot) AB hydrolase superfamily (according to Swiss-Prot)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|4U0O] (from ''Thermosynechococcus elongatus'', 48% identity) [Pubmed|25100160]
  • Expression and Regulation

    Operons

    genes
    [gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B578 (yutB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1577 NBRP B. subtilis, Japan]
  • BKE32330 (Δ[gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCATCATCTCCAAT, downstream forward: _UP4_TAATGCCAAAACGCCAGATC
  • BKK32330 (Δ[gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCATCATCTCCAAT, downstream forward: _UP4_TAATGCCAAAACGCCAGATC
  • References

    Reviews

  • 27074917
  • Original publications

  • 18957862,19028902,19820084,25100160