SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


lipoyl synthase, trigger enzyme
33.77 kDa
protein length
298 aa Sequence Blast
gene length
897 bp Sequence Blast
synthesis of lipoic acid
lipoyl synthase,trigger enzyme

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis and scavenging of lipoic acid]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW|Trigger enzymes that control transcription in a yet unknown way]
  • Gene

    3,320,324 3,321,220

    Phenotypes of a mutant

  • reduced transformation efficiency [Pubmed|19028902]
  • strong inhibition of growth on minimal media [Pubmed|19820084]
  • The protein

    Catalyzed reaction/ biological activity

  • Protein N6-(octanoyl)lysine + 2 sulfur-(sulfur carrier) + 2 S-adenosyl-L-methionine + 2 reduced [2Fe-2S] ferredoxin = protein N6-(lipoyl)lysine + 2 (sulfur carrier) + 2 L-methionine + 2 5'-deoxyadenosine + 2 oxidized [2Fe-2S] ferredoxin (according to Swiss-Prot)
  • Triacylglycerol + H2O = diacylglycerol + a carboxylate (according to Swiss-Prot) required for ''[gene|788725411B2E741103603373E43441FD036E1BA0|comEA]'' transcription [Pubmed|19028902]
  • Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|4U0O] (from ''Thermosynechococcus elongatus'', 48% identity) [Pubmed|25100160]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B578 (yutB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32330 ([gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCATCATCTCCAAT, downstream forward: _UP4_TAATGCCAAAACGCCAGATC
  • BKK32330 ([gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCATCATCTCCAAT, downstream forward: _UP4_TAATGCCAAAACGCCAGATC
  • References


  • 27074917
  • Original publications

  • 18957862,19028902,19820084,25100160