SubtiBank SubtiBank
lipA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lipA

lipoyl synthase, trigger enzyme
locus
BSU_32330
pI
8.25
mw
33.77 kDa
protein length
298 aa Sequence Blast
gene length
897 bp Sequence Blast
function
synthesis of lipoic acid
product
lipoyl synthase,trigger enzyme
essential
no
ec
2.8.1.8
synonyms
yutB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.7|Biosynthesis and scavenging of lipoic acid]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.5|Trigger enzymes that control transcription in a yet unknown way]
  • Gene

    Coordinates
    3,320,324 3,321,220

    Phenotypes of a mutant

  • reduced transformation efficiency [Pubmed|19028902]
  • strong inhibition of growth on minimal media [Pubmed|19820084]
  • The protein

    Catalyzed reaction/ biological activity

  • Protein N6-(octanoyl)lysine + 2 sulfur-(sulfur carrier) + 2 S-adenosyl-L-methionine + 2 reduced [2Fe-2S] ferredoxin = protein N6-(lipoyl)lysine + 2 (sulfur carrier) + 2 L-methionine + 2 5'-deoxyadenosine + 2 oxidized [2Fe-2S] ferredoxin (according to Swiss-Prot)
  • Triacylglycerol + H2O = diacylglycerol + a carboxylate (according to Swiss-Prot) required for ''[gene|788725411B2E741103603373E43441FD036E1BA0|comEA]'' transcription [Pubmed|19028902]
  • Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|4U0O] (from ''Thermosynechococcus elongatus'', 48% identity) [Pubmed|25100160]
  • Expression and Regulation

    Operons

    genes
    [gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B578 (yutB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1577 NBRP B. subtilis, Japan]
  • BKE32330 ([gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCATCATCTCCAAT, downstream forward: _UP4_TAATGCCAAAACGCCAGATC
  • BKK32330 ([gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCATCATCTCCAAT, downstream forward: _UP4_TAATGCCAAAACGCCAGATC
  • References

    Reviews

  • 27074917
  • Original publications

  • 18957862,19028902,19820084,25100160