SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


lipoyl synthase, trigger enzyme
33.77 kDa
protein length
298 aa Sequence Blast
gene length
894 bp Sequence Blast
synthesis of lipoic acid
lipoyl synthase,trigger enzyme

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of lipoic acid]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW|Trigger enzymes that control transcription in a yet unknown way]
  • Gene

    3,320,324 → 3,321,220

    Phenotypes of a mutant

  • reduced transformation efficiency [Pubmed|19028902]
  • strong inhibition of growth on minimal media [Pubmed|19820084]
  • The protein

    Catalyzed reaction/ biological activity

  • Protein N6-(octanoyl)lysine + 2 sulfur-(sulfur carrier) + 2 S-adenosyl-L-methionine + 2 reduced [2Fe-2S] ferredoxin = protein N6-(lipoyl)lysine + 2 (sulfur carrier) + 2 L-methionine + 2 5'-deoxyadenosine + 2 oxidized [2Fe-2S] ferredoxin (according to Swiss-Prot)
  • Triacylglycerol + H2O = diacylglycerol + a carboxylate (according to Swiss-Prot) required for ''[gene|788725411B2E741103603373E43441FD036E1BA0|comEA]'' transcription [Pubmed|19028902]
  • Protein family

  • Lipoyl synthase family (according to Swiss-Prot) AB hydrolase superfamily (according to Swiss-Prot)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|4U0O] (from ''Thermosynechococcus elongatus'', 48% identity) [Pubmed|25100160]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B578 (yutB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32330 (Δ[gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCATCATCTCCAAT, downstream forward: _UP4_TAATGCCAAAACGCCAGATC
  • BKK32330 (Δ[gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCATCATCTCCAAT, downstream forward: _UP4_TAATGCCAAAACGCCAGATC
  • References


  • 27074917
  • Original publications

  • 18957862,19028902,19820084,25100160