SubtiBank SubtiBank
ylbC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylbC

unknown
locus
BSU_14960
pI
7.37
mw
39.48 kDa
protein length
346 aa Sequence Blast
gene length
1041 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,566,379 1,567,419

    The protein

    [SW|Domains]

  • SCP domain (aa 231-342) (according to UniProt)
  • Structure

  • [PDB|4IFA] (from B. anthracis, 44% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|8529D83560E934709B20CCF0B72251A74EC272BB|ylbB]-[gene|2EC813B89149AD39405E66C325FB2684B5987162|ylbC]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B243 (ylbC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1242 NBRP B. subtilis, Japan]
  • BKE14960 ([gene|2EC813B89149AD39405E66C325FB2684B5987162|ylbC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTATCACCCCCGTGGC, downstream forward: _UP4_TAATGAAAGCCGCGGACGAA
  • BKK14960 ([gene|2EC813B89149AD39405E66C325FB2684B5987162|ylbC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTATCACCCCCGTGGC, downstream forward: _UP4_TAATGAAAGCCGCGGACGAA
  • References

  • 16497325,15699190