SubtiBank SubtiBank
lgt

lgt

prolipoprotein diacylglyceryl transferase
locus
BSU_34990
pI
8.96
mw
30.47 kDa
protein length
269 aa Sequence Blast
gene length
810 bp Sequence Blast
function
lipomodification of lipoproteins
product
prolipoprotein diacylglyceryl transferase
essential
no
ec
2.4.99.-
synonyms
gerF,yvoC

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.1|Protein maturation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,593,419 3,594,228

    Phenotypes of a mutant

  • reduced ability of spores to germinate with alanine due ti reduced activity of the [protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|GerAA]-[protein|5FF739B8C087207039BB6DC293EE77F59337ED0B|GerAB]-[protein|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|GerAC] germinant receptor [Pubmed|15126458]
  • inactivation of ''[gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]'' reduces sporulation efficiency to 7.7% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) + L-cysteinyl-[prolipoprotein] --> H+ + S-1,2-diacyl-sn-glyceryl-L-cysteinyl-[prolipoprotein] + sn-glycerol 1-phosphate (according to UniProt)
  • Protein family

  • lgt family (single member, according to UniProt)
  • Structure

  • [PDB|5AZB] (from E. coli, 29% identity) [pubmed|26729647]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK]-[gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]-[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]-[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]-[gene|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|yvoF]
    description
    [Pubmed|9465101]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A388 (lgt::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/388 NBRP B. subtilis, Japan]
  • GP851 (Δ[gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]-[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]-[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]-[gene|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|yvoF])::aphA3), available in [SW|Jörg Stülke]'s lab
  • 1G22 ( ''lgt''::''erm''), [Pubmed|15126458], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1G22&Search=1G22 BGSC]
  • BKE34990 (Δ[gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTTCATTCATTTAACGCC, downstream forward: _UP4_TAGACGTCAACAAAGGGGGA
  • BKK34990 (Δ[gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTTCATTCATTTAACGCC, downstream forward: _UP4_TAGACGTCAACAAAGGGGGA
  • References

    Reviews

  • 21663440
  • Original publications

  • 9882689,10096076,15126458,18763711,9465101,22493018,9846746,26735940
  • Lgt in other organisms

  • 22287519,26729647