SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


flagellar C ring protein, [protein|2F0495C7EAB81BDB1F3181677C555537BD2A972F|CheY]-P phosphatase
40.89 kDa
protein length
378 aa Sequence Blast
gene length
1137 bp Sequence Blast
movement and chemotaxis
flagellar C ring protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    1,702,672 1,703,808

    Phenotypes of a mutant

  • A ''[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]'' null mutant has no flagella [Pubmed|1447979].
  • The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of [protein|2F0495C7EAB81BDB1F3181677C555537BD2A972F|CheY]-P [pubmed|30455280]
  • Protein family

  • FliN/MopA/SpaO family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|CheC], [protein|1D51AF3E6456F126203D7C7273FB828A47E26DFB|FliM]
  • Modification

  • phosphorylated on Arg-251 [Pubmed|22517742]
  • Structure

  • [PDB|4HYN] (from Thermotoga maritima, corresponds to aa 33 ... 172, 47% identity) [pubmed|23532838]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE16320 ([gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTATTCTCCATCTTGTTC, downstream forward: _UP4_TAACGAAACACAAGGAGAGA
  • BKK16320 ([gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTATTCTCCATCTTGTTC, downstream forward: _UP4_TAACGAAACACAAGGAGAGA
  • References


  • 26195616,30718302
  • Original Publications

  • 14749334,1447979,25733861,14651647,9657996,8157612,15175317,12920116,17850253,22517742,24386445,30455280,23532838