SubtiBank SubtiBank
ndoA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ndoA

RNase EndoA, MazF family toxin, UACAU-specific mRNA interferase
locus
BSU_04660
pI
4.89
mw
12.84 kDa
protein length
116 aa Sequence Blast
gene length
351 bp Sequence Blast
function
unknown
product
mRNA interferase
essential
no
synonyms
ydcE,mazF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • Gene

    Coordinates
    518,943 519,293

    The protein

    Catalyzed reaction/ biological activity

  • specifically cleaves a five-base sequence, UACAU [Pubmed|21763692]
  • Protein family

  • PemK/MazF family (single member, according to UniProt)
  • Effectors of protein activity

  • the activity is inhibited by the interaction with [protein|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|NdoAI] [Pubmed|17416361]
  • Structure

  • [PDB|1NE8] [Pubmed|14517982]
  • [PDB|4MDX] (NdoA-RNA) [Pubmed|24120662]
  • [PDB|4ME7] ([protein|2E5A557E417CB355331CC0555D46A79793EB90B3|NdoA]-[protein|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|NdoAI] complex) [Pubmed|24120662]
  • Expression and Regulation

    Operons

    genes
    [gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]-[gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]
    description
    [Pubmed|15882409]

    additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|ndoA]' [PubMed|20525796]
  • view in new tab

    genes
    [gene|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|alr]-[gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]-[gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE04660 ([gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGCCGCGTTTCACAATCA, downstream forward: _UP4_TAGACATATTTGCAGGTTGC
  • BKK04660 ([gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGCCGCGTTTCACAATCA, downstream forward: _UP4_TAGACATATTTGCAGGTTGC
  • References

  • 15882409,17416361,20525796,21763692,21897862,23378533,14517982,24120662,24489751,23736285,28017721