SubtiBank SubtiBank
hrcA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hrcA

transcriptional repressor of class I heat-shock genes
locus
BSU25490
pI
6.08
mw
38.87 kDa
protein length
343 aa Sequence Blast
gene length
1032 bp Sequence Blast
function
regulation of chaperone gene expression
product
transcriptional repressor
essential
no
synonyms
yqxE,yqeS

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,628,606 2,629,637

    The protein

    Catalyzed reaction/ biological activity

  • transcription repressor of the ''[gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]'' and ''[gene|0D8B3F1F86FDBAE0F3B3651F456340F147B394AF|groES]-[gene|8F3DEE8828CA6BAAAF6DB2DA4349EF7AA9DF89F8|groEL]'' operons (at low/ normal temperatures)
  • Protein family

  • hrcA family (according to Swiss-Prot)
  • Modification

  • phosphorylated on arginine residues [Pubmed|24263382]
  • [SW|Cofactors]

  • [protein|8F3DEE8828CA6BAAAF6DB2DA4349EF7AA9DF89F8|GroEL] acts as co-repressor
  • Structure

  • [PDB|1STZ] (from Thermotoga maritima, 27% identity) [pubmed|15979091]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]
    description
    [Pubmed|9023197]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    Biological materials

    Mutant

  • BKE25490 ([gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCACCTCTGTTA, downstream forward: _UP4_TAAGGGAATTTTGGCAAATT
  • BKK25490 ([gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCACCTCTGTTA, downstream forward: _UP4_TAAGGGAATTTTGGCAAATT
  • labs

  • [SW|Wolfgang Schumann], Bayreuth University, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/schumann_research.htm Homepage]
  • [SW|Thomas Wiegert], University of Bayreuth, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/Thomas Wiegert-Dateien/Thomas Wiegert.html Homepage]
  • References

    Reviews

  • 27518094,28402413
  • Original Publications

  • 8113175,9023197,9303302,10383760,8576042,12799007,11717291,12082092,1339421,7540247,1339421,9303302,7592421,24263382,15979091