SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional repressor of class I heat-shock genes
38.87 kDa
protein length
343 aa Sequence Blast
gene length
1032 bp Sequence Blast
regulation of chaperone gene expression
transcriptional repressor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,628,606 2,629,637

    The protein

    Catalyzed reaction/ biological activity

  • transcription repressor of the ''[gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]'' and ''[gene|0D8B3F1F86FDBAE0F3B3651F456340F147B394AF|groES]-[gene|8F3DEE8828CA6BAAAF6DB2DA4349EF7AA9DF89F8|groEL]'' operons (at low/ normal temperatures)
  • Protein family

  • hrcA family (single member, according to UniProt)
  • Modification

  • phosphorylated on arginine residues [Pubmed|24263382]
  • [SW|Cofactors]

  • [protein|8F3DEE8828CA6BAAAF6DB2DA4349EF7AA9DF89F8|GroEL] acts as co-repressor
  • Structure

  • [PDB|1STZ] (from Thermotoga maritima, 27% identity) [pubmed|15979091]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    Biological materials


  • BKE25490 ([gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCACCTCTGTTA, downstream forward: _UP4_TAAGGGAATTTTGGCAAATT
  • BKK25490 ([gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCACCTCTGTTA, downstream forward: _UP4_TAAGGGAATTTTGGCAAATT
  • labs

  • [SW|Wolfgang Schumann], Bayreuth University, Germany [ Homepage]
  • [SW|Thomas Wiegert], University of Bayreuth, Germany [ Wiegert-Dateien/Thomas Wiegert.html Homepage]
  • References


  • 27518094,28402413
  • Original Publications

  • 8113175,9023197,9303302,10383760,8576042,12799007,11717291,12082092,1339421,7540247,1339421,9303302,7592421,24263382,15979091