SubtiBank SubtiBank
yfnB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfnB

putative [SW|HAD superfamily] phosphatase
locus
BSU_07330
pI
4.63
mw
27.23 kDa
protein length
235 aa Sequence Blast
gene length
708 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    804,657 805,364

    The protein

    Protein family

  • [SW|HAD superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|50417B2FA0ED2258A13B1E708514F055297599EF|SerB]
  • Structure

  • [PDB|3ED5]
  • Expression and Regulation

    Operons

    genes
    [gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]-[gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C327 (yfnB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2325 NBRP B. subtilis, Japan]
  • BKE07330 ([gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGTGTCTCCCTTTC, downstream forward: _UP4_TAATCAGGCTGACGGTATTT
  • BKK07330 ([gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGTGTCTCCCTTTC, downstream forward: _UP4_TAATCAGGCTGACGGTATTT