SubtiBank SubtiBank
rhiF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rhiF

[SW|ABC transporter] (membrane protein) for rhamnose oligosaccharides
locus
BSU06980
pI
9.47
mw
34.46 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast
function
uptake of rhamnose oligosaccharides
product
rhamnose oligosaccharide [SW|ABC transporter]
essential
no
synonyms
yesP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    762,942 763,871

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Structure

  • [PDB|4TQU] (from Sphingomonas sp., corresponds to aa 13 - 231, 28% identity) [pubmed|26235029]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Biological materials

    Mutant

  • MGNA-A948 (yesP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/948 NBRP B. subtilis, Japan]
  • BKE06980 ([gene|2DC415DCC2ECC3B46526108638DDB46C28832041|rhiF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCGTCAGCCCCATTTC, downstream forward: _UP4_TACGAGTCAAAGGAGGAATG
  • BKK06980 ([gene|2DC415DCC2ECC3B46526108638DDB46C28832041|rhiF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCGTCAGCCCCATTTC, downstream forward: _UP4_TACGAGTCAAAGGAGGAATG
  • References

  • 10092453,17449691,24391637,26235029