SubtiBank SubtiBank
rhiF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rhiF

[SW|ABC transporter] (membrane protein) for rhamnose oligosaccharides
locus
BSU_06980
pI
9.47
mw
34.46 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast
function
uptake of rhamnose oligosaccharides
product
rhamnose oligosaccharide [SW|ABC transporter]
essential
no
synonyms
yesP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    762,942 763,871

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|MalFG subfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 80-294) (according to UniProt)
  • Structure

  • [PDB|4TQU] (from Sphingomonas sp., corresponds to aa 13 - 231, 28% identity) [pubmed|26235029]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]-[gene|2DC415DCC2ECC3B46526108638DDB46C28832041|rhiF]-[gene|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|rhiG]-[gene|8EED04FCE6E2900B729178209FB281F5463B2540|rhiN]
    description
    [Pubmed|33122638]

    regulation

  • induced in colonies growing on steamed soybeans [Pubmed|33122638]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A948 (yesP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/948 NBRP B. subtilis, Japan]
  • BKE06980 ([gene|2DC415DCC2ECC3B46526108638DDB46C28832041|rhiF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCGTCAGCCCCATTTC, downstream forward: _UP4_TACGAGTCAAAGGAGGAATG
  • BKK06980 ([gene|2DC415DCC2ECC3B46526108638DDB46C28832041|rhiF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCGTCAGCCCCATTTC, downstream forward: _UP4_TACGAGTCAAAGGAGGAATG
  • References

  • 10092453,17449691,24391637,26235029