SubtiBank SubtiBank
yhfK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhfK

unknown
locus
BSU_10260
pI
5.18
mw
22.61 kDa
protein length
214 aa Sequence Blast
gene length
645 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,100,219 1,100,863

    The protein

    Protein family

  • [SW|NAD(P)-dependent epimerase/dehydratase family] (according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Structure

  • [PDB|3E8X] (from B. halodurans, 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|8FA225FA26DB0B89812A835EB928F2C8892EBC89|yhfI]-[gene|F68611DF326880FCCB4EE3C2B364ECCC3DEAD78D|lplJ]-[gene|2DA0641FA6EC81072DA585D65FE17B7E5A010AC9|yhfK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A711 (yhfK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/711 NBRP B. subtilis, Japan]
  • BKE10260 ([gene|2DA0641FA6EC81072DA585D65FE17B7E5A010AC9|yhfK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATCCCTCCTGCCT, downstream forward: _UP4_TGACAGTACTGACACTCAGG
  • BKK10260 ([gene|2DA0641FA6EC81072DA585D65FE17B7E5A010AC9|yhfK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAATCCCTCCTGCCT, downstream forward: _UP4_TGACAGTACTGACACTCAGG
  • References

  • 16493705