SubtiBank SubtiBank
ywcI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywcI

unknown
locus
BSU_38080
pI
11.11
mw
11.63 kDa
protein length
100 aa Sequence Blast
gene length
303 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-46d

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,907,012 3,907,314

    Expression and Regulation

    Operons

    genes
    [gene|2D58D48D81ADD705B519D202568939B980AF86DB|ywcI]-[gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B673 (ywcI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1672 NBRP B. subtilis, Japan]
  • BKE38080 ([gene|2D58D48D81ADD705B519D202568939B980AF86DB|ywcI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAAAAACATCCCTCCG, downstream forward: _UP4_TAAAATCCCAGTCAAAAGCA
  • BKK38080 ([gene|2D58D48D81ADD705B519D202568939B980AF86DB|ywcI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAAAAACATCCCTCCG, downstream forward: _UP4_TAAAATCCCAGTCAAAAGCA
  • References

  • 12107147,21815947,26020636