SubtiBank SubtiBank
ytcQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytcQ

polygalacturonan and rhamnogalacturonan [SW|ABC transporter] (solute-binding lipoprotein)
locus
BSU30160
pI
4.96
mw
55.14 kDa
protein length
498 aa Sequence Blast
gene length
1497 bp Sequence Blast
function
uptake of polygalacturonan and rhamnogalacturonan
product
polygalacturonan and rhamnogalacturonan [SW|ABC transporter] (solute-binding lipoprotein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,085,800 3,087,296

    The protein

    Protein family

  • [SW|Bacterial solute-binding protein 1 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|A4DA5C00BA37FF65E4190EC95B183ABAF1C9364D|LplA]
  • [SW|Localization]

  • associated to the membrane (via [protein|87B212C8C61483DF2874762A3B77111616C616A5|YtcP]-[protein|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|YteP]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|87B212C8C61483DF2874762A3B77111616C616A5|ytcP]-[gene|2D46E89AF6157B49BD443F47DB4A7258F22E8A24|ytcQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A806 (ytcQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/806 NBRP B. subtilis, Japan]
  • BKE30160 ([gene|2D46E89AF6157B49BD443F47DB4A7258F22E8A24|ytcQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTACCCCTCCGTTTCA, downstream forward: _UP4_TAACATTGGAAAAACCCAAA
  • BKK30160 ([gene|2D46E89AF6157B49BD443F47DB4A7258F22E8A24|ytcQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTACCCCTCCGTTTCA, downstream forward: _UP4_TAACATTGGAAAAACCCAAA
  • References

  • 10092453,22383849,29240795