SubtiBank SubtiBank
yfkJ [2019-07-25 09:15:23]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yfkJ [2019-07-25 09:15:23]

general stress protein, protein tyrosine phosphatase, required for protection against paraquat stress
17.13 kDa
protein length
156 aa Sequence Blast
gene length
471 bp Sequence Blast
survival of stress conditions
protein tyrosine phosphatase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    862,004 862,474

    The protein

    Catalyzed reaction/ biological activity

  • Protein tyrosine phosphate + H2O = protein tyrosine + phosphate (according to Swiss-Prot)
  • Protein family

  • low molecular weight phosphotyrosine protein phosphatase family (with [protein|DB3527FB78D0B7C144D1699D665788184F19AFE0|ArsC] and [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|YwlE], according to UniProt)
  • Paralogous protein(s)

  • [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|YwlE]
  • Structure

  • [PDB|4ETM]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11532142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,11532142], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528,11532142]
  • view in new tab

    Biological materials


  • MGNA-C266 (yfkJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07880 ([gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTGCAACCTCCCTA, downstream forward: _UP4_TTGTGAGTGAAAGGAGAATT
  • BKK07880 ([gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTGCAACCTCCCTA, downstream forward: _UP4_TTGTGAGTGAAAGGAGAATT
  • References

  • 15866923,15995210,22582280,15805528,11532142