SubtiBank SubtiBank
yfkJ

yfkJ

general stress protein, protein tyrosine phosphatase, required for protection against paraquat stress
locus
BSU_07880
pI
4.56
mw
17.13 kDa
protein length
156 aa Sequence Blast
gene length
471 bp Sequence Blast
function
survival of stress conditions
product
protein tyrosine phosphatase
essential
no
ec
3.1.3.48
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    862,004 862,474

    The protein

    Catalyzed reaction/ biological activity

  • H2O + O-phospho-L-tyrosyl-[protein] --> L-tyrosyl-[protein] + phosphate (according to UniProt)
  • Protein family

  • low molecular weight phosphotyrosine protein phosphatase family (with [protein|DB3527FB78D0B7C144D1699D665788184F19AFE0|ArsC] and [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|YwlE], according to UniProt)
  • Paralogous protein(s)

  • [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|YwlE]
  • Structure

  • [PDB|4ETM]
  • Expression and Regulation

    Operons

    genes
    [gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]-[gene|A38D85EE1BCCA5E5E77CAF9583E7D052BB7F8188|yfkI]-[gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11532142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,11532142], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528,11532142]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C266 (yfkJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2264 NBRP B. subtilis, Japan]
  • BKE07880 ([gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTGCAACCTCCCTA, downstream forward: _UP4_TTGTGAGTGAAAGGAGAATT
  • BKK07880 ([gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTGCAACCTCCCTA, downstream forward: _UP4_TTGTGAGTGAAAGGAGAATT
  • References

  • 15866923,15995210,22582280,15805528,11532142