SubtiBank SubtiBank
bacD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bacD

alanine-anticapsin ligase
locus
BSU37710
pI
4.68
mw
52.10 kDa
protein length
472 aa Sequence Blast
gene length
1419 bp Sequence Blast
function
biosynthesis of the antibiotic bacilysin
product
alanine-anticapsin ligase
essential
no
ec
6.3.2.28
synonyms
ywfE, ipa-83d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    3,870,668 3,872,086

    Phenotypes of a mutant

  • a ''bacD'' point mutation has been isolated upon selction at low pressure [Pubmed|26296725]
  • The protein

    Catalyzed reaction/ biological activity

  • ligation of anticapsin to L-Ala to form bacilysin, ultimate step in bacilysin biosynthesis [Pubmed|23317005]
  • Structure

  • [PDB|3VMM] [Pubmed|22407814]
  • Expression and Regulation

    Operons

    genes
    [gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]-[gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]-[gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]-[gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]-[gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]-[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]
    description
    [Pubmed|12372825]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B241 (ywfE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1240 NBRP B. subtilis, Japan]
  • BKE37710 ([gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCCATATGTAAAACACTCC, downstream forward: _UP4_ACGGCAAAGTATGTGCTGCC
  • BKK37710 ([gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCCATATGTAAAACACTCC, downstream forward: _UP4_ACGGCAAAGTATGTGCTGCC
  • References

  • 16030213,12372825,19352016,19801406,21948839,22407814,24702628,23317005,12697329,21709425,22298000,26296725