SubtiBank SubtiBank
ydiL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydiL

unknown
locus
BSU_06010
pI
8.69
mw
27.44 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    648,930 649,664

    The protein

    Protein family

  • peptidase U48 family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|2CC1B4F99EFF51A1F6352C3EFBF70E36893A025C|ydiL]-[gene|0E5315E07141A4D7BB43E82ACAF163639CBD970F|ydiK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C204 (ydiL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2202 NBRP B. subtilis, Japan]
  • BKE06010 ([gene|2CC1B4F99EFF51A1F6352C3EFBF70E36893A025C|ydiL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGGTATGTACTCCTTT, downstream forward: _UP4_TTGATTATTGGAGGATTATT
  • BKK06010 ([gene|2CC1B4F99EFF51A1F6352C3EFBF70E36893A025C|ydiL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGGTATGTACTCCTTT, downstream forward: _UP4_TTGATTATTGGAGGATTATT
  • References

  • 22383849