SubtiBank SubtiBank
ytxK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytxK

similar to SAM-dependent methyltransferase
locus
BSU_29480
pI
5.41
mw
37.20 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast
function
DNA modification
product
similar to SAM-dependent DNA-methyltransferase
essential
no
synonyms
ythI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.8|Genetics/ other/ based on similarity]
  • Gene

    Coordinates
    3,016,646 3,017,635

    The protein

    Structure

  • [PDB|2F8L] (from Listeria monocytogenes, 45% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|2501228D435B151F151A3C0EF10DE99A8395977F|tpx]-[gene|2C83EECFA809F34ADCA6445CF2E6BAC730D523DB|ytxK]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|12642660,19575568], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    genes
    [gene|2C83EECFA809F34ADCA6445CF2E6BAC730D523DB|ytxK]
    description
    [Pubmed|8226682]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A114 (ytxK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/114 NBRP B. subtilis, Japan]
  • BKE29480 ([gene|2C83EECFA809F34ADCA6445CF2E6BAC730D523DB|ytxK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTGTTCCTCCTTGC, downstream forward: _UP4_TAAGTGTTTTAAAAGCAGCT
  • BKK29480 ([gene|2C83EECFA809F34ADCA6445CF2E6BAC730D523DB|ytxK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTGTTCCTCCTTGC, downstream forward: _UP4_TAAGTGTTTTAAAAGCAGCT
  • References

  • 8226682