SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to SAM-dependent methyltransferase
37.20 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast
DNA modification
similar to SAM-dependent DNA-methyltransferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.8|Genetics/ other/ based on similarity]
  • Gene

    3,016,646 3,017,635

    The protein


  • [PDB|2F8L] (from Listeria monocytogenes, 45% identity)
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|12642660,19575568], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-A114 (ytxK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29480 ([gene|2C83EECFA809F34ADCA6445CF2E6BAC730D523DB|ytxK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTGTTCCTCCTTGC, downstream forward: _UP4_TAAGTGTTTTAAAAGCAGCT
  • BKK29480 ([gene|2C83EECFA809F34ADCA6445CF2E6BAC730D523DB|ytxK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTGTTCCTCCTTGC, downstream forward: _UP4_TAAGTGTTTTAAAAGCAGCT
  • References

  • 8226682