SubtiBank SubtiBank
gerPC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerPC

spore germination protein, facilitates access of nutrient germinants to their cognate germinant receptors in spores inner membrane
locus
BSU10700
pI
4.76
mw
24.09 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
function
germination
product
unknown
essential
no
synonyms
yisF

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    1,149,318 1,149,935

    Expression and Regulation

    Operons

    genes
    [gene|C4DA51243A4249B2489133C8EF0F8A30B05F4C86|gerPA]-[gene|B52A09BF195FE8E143FCB2EF5EBA53454A4ED3D5|gerPB]-[gene|2C49C261D2C7EEDD8E01A384917B63B6965B4AB9|gerPC]-[gene|F8658BB6D52793F8EC289FEC652241D729D72BF6|gerPD]-[gene|53833A2E7176C04AF2E3F7CD7FC9928DC1A0110D|gerPE]-[gene|C2DDBBD801BC61B89024198624360CC55D208247|gerPF]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,10715007]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|gerPA]' and '[protein|search|yisI]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B188 (yisF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1187 NBRP B. subtilis, Japan]
  • BKE10700 ([gene|2C49C261D2C7EEDD8E01A384917B63B6965B4AB9|gerPC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTCACCTCTTTCA, downstream forward: _UP4_GAAATGAAAGGAGATGAGCA
  • BKK10700 ([gene|2C49C261D2C7EEDD8E01A384917B63B6965B4AB9|gerPC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTCACCTCTTTCA, downstream forward: _UP4_GAAATGAAAGGAGATGAGCA
  • References

  • 10715007