SubtiBank SubtiBank
yxkC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxkC

unknown
locus
BSU_38850
pI
9.29
mw
22.00 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,989,232 3,989,873

    The protein

    [SW|Domains]

  • [SW|DUF4352] (aa 46 ... 175)(according to UniProt)
  • Structure

  • [PDB|4LES] (from B. anthracis, corresponds to aa 79 ... 213, 30% identity)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|2BFDEB28F3B2937DCECB2C45B40D4657B4613ED9|yxkC]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • repressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B737 (yxkC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1736 NBRP B. subtilis, Japan]
  • BKE38850 (''[gene|2BFDEB28F3B2937DCECB2C45B40D4657B4613ED9|yxkC]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP1824 (''[gene|2BFDEB28F3B2937DCECB2C45B40D4657B4613ED9|yxkC]''::''erm'', available in [SW|Jörg Stülke]'s lab)
  • BKE38850 ([gene|2BFDEB28F3B2937DCECB2C45B40D4657B4613ED9|yxkC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGTTACGTTGAT, downstream forward: _UP4_TAACAGCTAACAAGGGTGCC
  • BKK38850 ([gene|2BFDEB28F3B2937DCECB2C45B40D4657B4613ED9|yxkC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGTTACGTTGAT, downstream forward: _UP4_TAACAGCTAACAAGGGTGCC
  • References

  • 15033535,12823818,18957862,18763711,10746760,23033921