SubtiBank SubtiBank
yjaU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjaU

unknown
locus
BSU_11280
pI
7.94
mw
28.19 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,205,165 1,205,899

    Expression and Regulation

    Operons

    genes
    [gene|2BF1CA62F5B8B54A25B70721D39B5BD38C0203EB|yjaU]-[gene|D08B0A131374D2949ABC3EF8D6117C6BC6D94FE5|yjaV]-[gene|4DAB7847EA3848A34432C80124464543FA3DCA0F|med]-[gene|8914DE1312FD3C28E7D451A034814D92D1312B10|comZ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B143 (yjaU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1142 NBRP B. subtilis, Japan]
  • BKE11280 ([gene|2BF1CA62F5B8B54A25B70721D39B5BD38C0203EB|yjaU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCTTGCCCGCCTCCTT, downstream forward: _UP4_TAGAGAATATAATGACAACA
  • BKK11280 ([gene|2BF1CA62F5B8B54A25B70721D39B5BD38C0203EB|yjaU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCTTGCCCGCCTCCTT, downstream forward: _UP4_TAGAGAATATAATGACAACA