SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


probable DNA repair protein
26.00 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast
DNA repair
probable DNA repair protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,861,840 2,862,535

    The protein

    Protein family

  • UPF0758 family (single member, according to UniProt)
  • [SW|Domains]

  • MPN domain (aa 109-231) (according to UniProt)
  • Modification

  • phosphorylated on Arg-59 [Pubmed|22517742]
  • Structure

  • [PDB|2QLC] (C-terminal domain of Chlorobium tepidum RadC, 46% identity)
  • [SW|Localization]

  • cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, promoter p2 within [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, promoter p1, upstream of [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|26091431], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146,11918817,21564336], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials


  • GP3561 (Δ[gene|2BD11D71AA6D9EFAD8A209C8813CC8B059180C84|radC]::aphA3), available in [SW|Jörg Stülke]'s lab
  • MGNA-B011 (ysxA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28040 ([gene|2BD11D71AA6D9EFAD8A209C8813CC8B059180C84|radC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCACTCCTTTTCTTTCC, downstream forward: _UP4_TAACACTTTTTTTTTCGTCG
  • BKK28040 ([gene|2BD11D71AA6D9EFAD8A209C8813CC8B059180C84|radC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCACTCCTTTTCTTTCC, downstream forward: _UP4_TAACACTTTTTTTTTCGTCG
  • References

  • 17434969,11948146,11918817,16479537,12775685,18179421,22517742,24009114,21926231,22383849,26091431