SubtiBank SubtiBank
radC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

radC

probable DNA repair protein
locus
BSU_28040
pI
7.83
mw
26.00 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast
function
DNA repair
product
probable DNA repair protein
essential
no
synonyms
ysxA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,861,840 2,862,535

    The protein

    Protein family

  • UPF0758 family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-59 [Pubmed|22517742]
  • Structure

  • [PDB|2QLC] (C-terminal domain of Chlorobium tepidum RadC, 46% identity)
  • [SW|Localization]

  • cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|maf]-[gene|2BD11D71AA6D9EFAD8A209C8813CC8B059180C84|radC]-[gene|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB]-[gene|6A14D0C7FD94A838BAB3B74AA100EA678F1E4E34|mreC]-[gene|231C30963AFB863424C087CB722446D319976D65|mreD]-[gene|8C94C9598A823A8405B3E1FA0124E21D90845B8E|minC]-[gene|37DAD42A391E2FC506225EAF91B8F21629A401DF|minD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, promoter p2 within [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, promoter p1, upstream of [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|26091431], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146,11918817,21564336], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B011 (ysxA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1010 NBRP B. subtilis, Japan]
  • BKE28040 ([gene|2BD11D71AA6D9EFAD8A209C8813CC8B059180C84|radC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCACTCCTTTTCTTTCC, downstream forward: _UP4_TAACACTTTTTTTTTCGTCG
  • BKK28040 ([gene|2BD11D71AA6D9EFAD8A209C8813CC8B059180C84|radC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCACTCCTTTTCTTTCC, downstream forward: _UP4_TAACACTTTTTTTTTCGTCG
  • References

  • 17434969,11948146,11918817,16479537,12775685,18179421,22517742,24009114,21926231,22383849,26091431