SubtiBank SubtiBank
yqgS [2018-07-19 19:06:05]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqgS [2018-07-19 19:06:05]

polyglycerolphosphate lipoteichoic acid synthase
73.03 kDa
protein length
638 aa Sequence Blast
gene length
1914 bp Sequence Blast
biosynthesis of lipoteichoic acid
minor lipoteichoic acid synthase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of lipoteichoic acid]
  • Gene

    2,568,573 → 2,570,489

    The protein

    Protein family

  • LTA synthase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS], [protein|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|YvgJ], [protein|CCD06F344E3C87E77C3D13883CE2B927F372A84E|YfnI]
  • [SW|Localization]

  • localizes to the division septum [Pubmed|19229300]
  • Expression and Regulation



    additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab

    Biological materials


  • MGNA-C419 (yqgS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24840 (Δ[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACCTCCTATGCAG, downstream forward: _UP4_TAATCACAATGTCTCCCGCA
  • BKK24840 (Δ[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACCTCCTATGCAG, downstream forward: _UP4_TAATCACAATGTCTCCCGCA
  • References


  • Additional reviews:''' [Pubmed|21255102]
  • 21388439
  • Original publications

  • 19229300,21255105,23103977