SubtiBank SubtiBank
yqgS [2018-12-07 15:41:16]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqgS [2018-12-07 15:41:16]

polyglycerolphosphate lipoteichoic acid synthase
locus
BSU24840
pI
4.82
mw
73.03 kDa
protein length
638 aa Sequence Blast
gene length
1914 bp Sequence Blast
function
biosynthesis of lipoteichoic acid
product
minor lipoteichoic acid synthase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
  • Gene

    Coordinates
    2,568,573 → 2,570,489

    The protein

    Protein family

  • LTA synthase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS], [protein|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|YvgJ], [protein|CCD06F344E3C87E77C3D13883CE2B927F372A84E|YfnI]
  • Structure

  • [PDB|2W5Q] ([protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS] from S. aureus, corresponds to aa 218 ... 617 of [protein|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|YqgS]) [pubmed|19168632]
  • [SW|Localization]

  • localizes to the division septum [Pubmed|19229300]
  • Expression and Regulation

    Operons

    genes
    [gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]-[gene|C44F6723A2F1A627A0B9042871A07F5365D6121A|yqgO]-[gene|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|glcK]-[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]
    description
    [pubmed|22383849]

    additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C419 (yqgS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2417 NBRP B. subtilis, Japan]
  • BKE24840 (Δ[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACCTCCTATGCAG, downstream forward: _UP4_TAATCACAATGTCTCCCGCA
  • BKK24840 (Δ[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACCTCCTATGCAG, downstream forward: _UP4_TAATCACAATGTCTCCCGCA
  • References

    Reviews

  • Additional reviews:''' [Pubmed|21255102]
  • 21388439
  • Original publications

  • 19229300,21255105,23103977,19168632