SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


polyglycerolphosphate lipoteichoic acid synthase
73.03 kDa
protein length
638 aa Sequence Blast
gene length
1917 bp Sequence Blast
biosynthesis of lipoteichoic acid
minor lipoteichoic acid synthase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of lipoteichoic acid]
  • Gene

    2,568,573 2,570,489

    The protein

    Protein family

  • [SW|LTA synthase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS], [protein|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|YvgJ], [protein|CCD06F344E3C87E77C3D13883CE2B927F372A84E|YfnI]
  • Modification

  • can be phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] in vitro [pubmed|30478337]
  • Structure

  • [PDB|2W5Q] ([protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS] from S. aureus, corresponds to aa 218 ... 617 of [protein|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|YqgS]) [pubmed|19168632]
  • [SW|Localization]

  • localizes to the division septum [Pubmed|19229300]
  • Expression and Regulation



    additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab

    Biological materials


  • MGNA-C419 (yqgS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24840 ([gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACCTCCTATGCAG, downstream forward: _UP4_TAATCACAATGTCTCCCGCA
  • BKK24840 ([gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAACCTCCTATGCAG, downstream forward: _UP4_TAATCACAATGTCTCCCGCA
  • References


  • Additional reviews:''' [Pubmed|21255102]
  • 21388439
  • Original publications

  • 19229300,21255105,23103977,19168632,30478337