SubtiBank SubtiBank
yjbO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjbO

similar to pseudouridylate synthase
locus
BSU_11620
pI
6.55
mw
31.32 kDa
protein length
283 aa Sequence Blast
gene length
852 bp Sequence Blast
function
RNA modification
product
putative pseudouridylate synthase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.3|rRNA modification and maturation/ based on similarity]
  • Gene

    Coordinates
    1,238,523 1,239,374

    The protein

    Catalyzed reaction/ biological activity

  • uridine in RNA --> ψ-uridine in RNA (according to UniProt)
  • Protein family

  • [SW|S4 RNA-binding domain] superfamily (according to http://www.ebi.ac.uk/interpro/entry/IPR036986 Interpro)
  • pseudouridine synthase RluA family (with [protein|064AE8CE6D52E35582F90654AA9548963573C05C|YhcT] and [protein|C8C2E2F1B739F3D9A2FA6B460998708AAB2DA495|YlyB], according to UniProt)
  • Paralogous protein(s)

  • [protein|C8C2E2F1B739F3D9A2FA6B460998708AAB2DA495|YlyB], [protein|064AE8CE6D52E35582F90654AA9548963573C05C|YhcT]
  • [SW|Domains]

  • [SW|S4 RNA-binding domain] (aa 25-79) (according to UniProt)
  • Structure

  • [PDB|1V9F] (RluD from E. coli, 40% identical, aa 64 - 279) [pubmed|15078091]
  • Expression and Regulation

    Operons

    genes
    [gene|E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728|yjbL]-[gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]-[gene|2A2640A0501ECEA44A3C0C4842FAC053FB422A1F|nadF]-[gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]
    description
    [Pubmed|18067544]

    regulation

  • expressed during exponential growth
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B161 (yjbO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1160 NBRP B. subtilis, Japan]
  • BKE11620 ([gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCGTCCTCAGCGGAAG, downstream forward: _UP4_GAGAATCATTGATTCTCTCC
  • BKK11620 ([gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCGTCCTCAGCGGAAG, downstream forward: _UP4_GAGAATCATTGATTCTCTCC
  • References

  • 18067544,15078091