SubtiBank SubtiBank
mlpA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mlpA

metallopeptidase, involved in regulation of protease gene expression
locus
BSU_16710
pI
5.28
mw
45.80 kDa
protein length
409 aa Sequence Blast
gene length
1230 bp Sequence Blast
function
control of proteolyticc activity
product
specific processing protease
essential
no
synonyms
ymxG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • Gene

    Coordinates
    1,742,617 1,743,846

    Phenotypes of a mutant

  • fivefold increased levels of proteolytic activity in their growth medium [Pubmed|10666719]
  • The protein

    Protein family

  • [SW|Peptidase M16 family] (according to UniProt)
  • Structure

  • [PDB|3HDI] (from B. halodurans, 64% identity) [pubmed|19913481]
  • Expression and Regulation

    Operons

    genes
    [gene|2AD0F2C0B0957A9E77EF9771D010ED77459B8CC0|mlpA]
    description
    [Pubmed|8098035]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A057 (ymxG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/57 NBRP B. subtilis, Japan]
  • deletion mutant, available in [SW|van Dijl] lab
  • BKE16710 ([gene|2AD0F2C0B0957A9E77EF9771D010ED77459B8CC0|mlpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGTTCCTCCTATTC, downstream forward: _UP4_TAAAAAGGAAAGCCTGCCCC
  • BKK16710 ([gene|2AD0F2C0B0957A9E77EF9771D010ED77459B8CC0|mlpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGTTCCTCCTATTC, downstream forward: _UP4_TAAAAAGGAAAGCCTGCCCC
  • References

  • 10666719,10974125,8098035,19913481
  • Labs working on this gene/protein

  • [SW|Jan Maarten van Dijl], Groningen, Netherlands