SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


toxic peptide, eliminates defective cells from developing biofilms
6.60 kDa
protein length
gene length
180 bp Sequence Blast
toxic peptide

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW|Type 1 TA systems]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,678,240 2,678,419

    The protein

    Catalyzed reaction/ biological activity

  • part of a type I toxin/antitoxin system (with [protein|EF79E525504B99CE40B2BD0EE0BB8F8A2E9C7F7B|RatA]) [Pubmed|27450630]
  • eliminates defective cells from developing biofilms [Pubmed|27450630]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16166525], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|EF79E525504B99CE40B2BD0EE0BB8F8A2E9C7F7B|RatA]: antisense RNA, in [regulon|EF79E525504B99CE40B2BD0EE0BB8F8A2E9C7F7B|RatA regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: transcription activation, undefined, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • induced by amino acid limitation [Pubmed|27450630]
  • additional information

  • next to '[protein|search|yonT]', the '[protein|search|txpA]' mRNA has the strongest Shine-Dalgarno region in 'B. subtilis' [PubMed|19210617]
  • view in new tab

    Biological materials


  • BKE26050 ([gene|2A6EE9A3A5B32554E87E356B8BD4E2ED7975429A|txpA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCACCTCCTTTCA, downstream forward: _UP4_TAGTTTCTTTTTTAAAAGCT
  • BKK26050 ([gene|2A6EE9A3A5B32554E87E356B8BD4E2ED7975429A|txpA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCACCTCCTTTCA, downstream forward: _UP4_TAGTTTCTTTTTTAAAAGCT
  • labs

  • [SW|Richard Losick], Harvard University, Cambridge, USA [ Homepage]
  • References


  • 23300472,31075979
  • Original publications

  • 16166525,19210617,23300471,27450630