SubtiBank SubtiBank
txpA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

txpA

toxic peptide, eliminates defective cells from developing biofilms
locus
BSU_26050
pI
8.14
mw
6.60 kDa
protein length
gene length
180 bp Sequence Blast
function
toxin
product
toxic peptide
essential
no
synonyms
yqcR

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.1|Type 1 TA systems]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,678,240 2,678,419

    The protein

    Catalyzed reaction/ biological activity

  • part of a type I toxin/antitoxin system (with [protein|EF79E525504B99CE40B2BD0EE0BB8F8A2E9C7F7B|RatA]) [Pubmed|27450630]
  • eliminates defective cells from developing biofilms [Pubmed|27450630]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|2A6EE9A3A5B32554E87E356B8BD4E2ED7975429A|txpA]
    description
    [Pubmed|16166525]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16166525], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|EF79E525504B99CE40B2BD0EE0BB8F8A2E9C7F7B|RatA]: antisense RNA, in [regulon|EF79E525504B99CE40B2BD0EE0BB8F8A2E9C7F7B|RatA regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: transcription activation, undefined, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • induced by amino acid limitation [Pubmed|27450630]
  • additional information

  • next to '[protein|search|yonT]', the '[protein|search|txpA]' mRNA has the strongest Shine-Dalgarno region in 'B. subtilis' [PubMed|19210617]
  • view in new tab

    Biological materials

    Mutant

  • BKE26050 ([gene|2A6EE9A3A5B32554E87E356B8BD4E2ED7975429A|txpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCACCTCCTTTCA, downstream forward: _UP4_TAGTTTCTTTTTTAAAAGCT
  • BKK26050 ([gene|2A6EE9A3A5B32554E87E356B8BD4E2ED7975429A|txpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCACCTCCTTTCA, downstream forward: _UP4_TAGTTTCTTTTTTAAAAGCT
  • labs

  • [SW|Richard Losick], Harvard University, Cambridge, USA [http://www.mcb.harvard.edu/Losick/ Homepage]
  • References

    Reviews

  • 23300472,31075979
  • Original publications

  • 16166525,19210617,23300471,27450630