SubtiBank SubtiBank
txpA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

txpA

toxic peptide, eliminates defective cells from developing biofilms
locus
BSU_26050
pI
8.14
mw
6.60 kDa
protein length
gene length
180 bp Sequence Blast
function
toxin
product
toxic peptide
essential
no
synonyms
yqcR

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.1|Type 1 TA systems]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,678,240 2,678,419

    The protein

    Catalyzed reaction/ biological activity

  • part of a type I toxin/antitoxin system (with [protein|EF79E525504B99CE40B2BD0EE0BB8F8A2E9C7F7B|RatA]) [Pubmed|27450630]
  • eliminates defective cells from developing biofilms [Pubmed|27450630]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|2A6EE9A3A5B32554E87E356B8BD4E2ED7975429A|txpA]
    description
    [Pubmed|16166525]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16166525], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|EF79E525504B99CE40B2BD0EE0BB8F8A2E9C7F7B|RatA]: antisense RNA, in [regulon|EF79E525504B99CE40B2BD0EE0BB8F8A2E9C7F7B|RatA regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: transcription activation, undefined, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • induced by amino acid limitation [Pubmed|27450630]
  • additional information

  • next to '[protein|search|yonT]', the '[protein|search|txpA]' mRNA has the strongest Shine-Dalgarno region in 'B. subtilis' [PubMed|19210617]
  • view in new tab

    Biological materials

    Mutant

  • BKE26050 ([gene|2A6EE9A3A5B32554E87E356B8BD4E2ED7975429A|txpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCACCTCCTTTCA, downstream forward: _UP4_TAGTTTCTTTTTTAAAAGCT
  • BKK26050 ([gene|2A6EE9A3A5B32554E87E356B8BD4E2ED7975429A|txpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCACCTCCTTTCA, downstream forward: _UP4_TAGTTTCTTTTTTAAAAGCT
  • labs

  • [SW|Richard Losick], Harvard University, Cambridge, USA [http://www.mcb.harvard.edu/Losick/ Homepage]
  • References

    Reviews

  • 23300472,31075979
  • Original publications

  • 16166525,19210617,23300471,27450630