SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


two-component ATP-dependent protease, ATPase subunit
52.42 kDa
protein length
467 aa Sequence Blast
gene length
1404 bp Sequence Blast
protein degradation
two-component ATP-dependent protease, ATPase subunit

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • Gene

    1,688,676 1,690,079

    Phenotypes of a mutant

  • impaired in swarming motility [pubmed|29629859]
  • The protein

    Protein family

  • ClpX chaperone family (with [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX], according to UniProt)
  • Structure

  • [PDB|1DO2] (from E. coli, 51% identity) [pubmed|10693812]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7783641], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|11331605], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|11331605]
  • additional information

  • the intracellular concentration of CodY is about 2.5 myM (according to [PubMed|20408793])
  • view in new tab

    Biological materials


  • BKE16160 ([gene|2A5A080273CB7698DFABB147F4143E90BBCA3B01|clpY]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGCCTCAAGTCCTTTC, downstream forward: _UP4_TGAAAAATTTAATATGAGGA
  • BKK16160 ([gene|2A5A080273CB7698DFABB147F4143E90BBCA3B01|clpY]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGCCTCAAGTCCTTTC, downstream forward: _UP4_TGAAAAATTTAATATGAGGA
  • References


  • 23479438,26639779
  • Original publications

  • 12805205,11179218,11331605,7783641,29629859,10693812