SubtiBank SubtiBank
clpY
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

clpY

two-component ATP-dependent protease, ATPase subunit
locus
BSU_16160
pI
5.31
mw
52.42 kDa
protein length
467 aa Sequence Blast
gene length
1404 bp Sequence Blast
function
protein degradation
product
two-component ATP-dependent protease, ATPase subunit
essential
no
synonyms
hslU,codX

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • Gene

    Coordinates
    1,688,676 1,690,079

    Phenotypes of a mutant

  • impaired in swarming motility [pubmed|29629859]
  • The protein

    Protein family

  • ClpX chaperone family (with [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX], according to UniProt)
  • Structure

  • [PDB|1DO2] (from E. coli, 51% identity) [pubmed|10693812]
  • Expression and Regulation

    Operons

    genes
    [gene|B6062575849EA65BB7B44A9723676885799E2759|trmFO]-[gene|89746E312F20C81BE3CFDFCE7D99B01C375C198B|codV]-[gene|F6B748621B312E0B5A0A0782F3944C3E8112D7A8|clpQ]-[gene|2A5A080273CB7698DFABB147F4143E90BBCA3B01|clpY]-[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7783641], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|11331605], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|11331605]
  • additional information

  • the intracellular concentration of CodY is about 2.5 myM (according to [PubMed|20408793])
  • view in new tab

    Biological materials

    Mutant

  • BKE16160 ([gene|2A5A080273CB7698DFABB147F4143E90BBCA3B01|clpY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGCCTCAAGTCCTTTC, downstream forward: _UP4_TGAAAAATTTAATATGAGGA
  • BKK16160 ([gene|2A5A080273CB7698DFABB147F4143E90BBCA3B01|clpY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGCCTCAAGTCCTTTC, downstream forward: _UP4_TGAAAAATTTAATATGAGGA
  • References

    Reviews

  • 23479438,26639779
  • Original publications

  • 12805205,11179218,11331605,7783641,29629859,10693812