SubtiBank SubtiBank
atpD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

atpD

ATP synthase, part of the F1 complex (subunit beta)
locus
BSU_36810
pI
4.61
mw
51.26 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
function
ATP synthesis
product
ATP synthase (subunit beta))
essential
no
ec
3.6.3.14
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW 2.1.5.1|ATPase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    3,781,491 3,782,912

    The protein

    Catalyzed reaction/ biological activity

  • ATP + 4 H+ + H2O --> ADP + 5 H+ + phosphate (according to UniProt), ATP synthesis [http://www.youtube.com/watch?v=uOoHKCMAUMc see a video]
  • Protein family

  • ATPase alpha/beta chains family (with [protein|E3FADE979CE6AB6315F67812608FCE00CF4E2453|AtpA] and [protein|401459F105BC8A8342341D953AE259D6C3868AB6|FliI], according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Effectors of protein activity

  • ATPase activity is inhibited upon binding of Mg-ADP to [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] [pubmed|30580998]
  • Structure

  • [PDB|1SKY] ([protein|E3FADE979CE6AB6315F67812608FCE00CF4E2453|AtpA]-[protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] complex from ''Bacillus sp.'', 88% identity) [Pubmed|9261073]
  • [PDB|see here an overview on ATPase structure]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • peripheral via theF0 complex
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI]-[gene|CC1894D90AC17487A286B2909964916825055F93|atpB]-[gene|6CF7F6303425D8A51E1E01BF18823139E4259A8F|atpE]-[gene|87311FEA265AD3F5526C78D631E7E51BBF01F0D6|atpF]-[gene|E956A30D97B2941108880F3AD48620C4DB6E0EBD|atpH]-[gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]-[gene|492EEC8068043DA770F5DC1D54799C4366AE9A01|atpG]-[gene|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD]-[gene|A9DA64F8C7A60E8E2B1EDC99BEA1BD7DD0135AA6|atpC]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • the mRNA is processed between [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI] and [gene|CC1894D90AC17487A286B2909964916825055F93|atpB] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE36810 ([gene|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCTATCCCTCCTGACA, downstream forward: _UP4_TAATCTGGTCCTAGGAGGGT
  • BKK36810 ([gene|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCTATCCCTCCTGACA, downstream forward: _UP4_TAATCTGGTCCTAGGAGGGT
  • References

    Reviews

  • 23356252,23341301,23267178,22822068,21524994,19489730,17208001,16730323
  • Original publications

  • 7961438,15378759,16493705,18763711,9261073,28516784,30580998