SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


ATP synthase, part of the F1 complex (subunit beta)
51.26 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
ATP synthesis
ATP synthase (subunit beta))

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW|ATPase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    3,781,491 3,782,912

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + H+(In) = ADP + phosphate + H+(Out) (according to Swiss-Prot), ATP synthesis [ see a video]
  • Protein family

  • ATPase alpha/beta chains family (according to Swiss-Prot)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Effectors of protein activity

  • ATPase activity is inhibited upon binding of Mg-ADP to [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] [pubmed|30580998]
  • Structure

  • [PDB|1SKY] ([protein|E3FADE979CE6AB6315F67812608FCE00CF4E2453|AtpA]-[protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] complex from ''Bacillus sp.'', 88% identity) [Pubmed|9261073]
  • [PDB|see here an overview on ATPase structure]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • peripheral via theF0 complex
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • the mRNA is processed between [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI] and [gene|CC1894D90AC17487A286B2909964916825055F93|atpB] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials


  • BKE36810 ([gene|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCTATCCCTCCTGACA, downstream forward: _UP4_TAATCTGGTCCTAGGAGGGT
  • BKK36810 ([gene|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCTATCCCTCCTGACA, downstream forward: _UP4_TAATCTGGTCCTAGGAGGGT
  • References


  • 23356252,23341301,23267178,22822068,21524994,19489730,17208001,16730323
  • Original publications

  • 7961438,15378759,16493705,18763711,9261073,28516784,30580998