SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


branched-chain amino acid aminotransferase
39.52 kDa
protein length
356 aa Sequence Blast
gene length
1071 bp Sequence Blast
biosynthesis of branched-chain amino acids
branched-chain amino acid aminotransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • Gene

    259,016 260,086

    The protein

    Catalyzed reaction/ biological activity

  • l-leucine + 2-oxoglutarate = 4-methyl-2-oxopentanoate + L-glutamate (according to Swiss-Prot)
  • Protein family

  • [SW|Class-IV pyridoxal-phosphate-dependent aminotransferase family] (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|8163996FCB9D02F771E7A04A91D5720027260F12|YwaA]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|3HT5] (from ''Mycobacterium tuberculosis'', 48% identity) [Pubmed|19923721]
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455,21699902,18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    Biological materials


  • MGNA-B939 (ybgE::erm), available at the [ NBRP B. subtilis, Japan]
  • a ''ybgE'' mutant and a ''[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd] [gene|2A20EF701B9F78FC21A33D6BD8ED862323BA59A8|ybgE] [gene|8163996FCB9D02F771E7A04A91D5720027260F12|ywaA]'' triple mutant are available in [SW|Linc Sonenshein]'s lab
  • BKE02390 ([gene|2A20EF701B9F78FC21A33D6BD8ED862323BA59A8|ybgE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTAATCAGCACACCTT, downstream forward: _UP4_TGAAAATCGAAAAAGAACCT
  • BKK02390 ([gene|2A20EF701B9F78FC21A33D6BD8ED862323BA59A8|ybgE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTAATCAGCACACCTT, downstream forward: _UP4_TGAAAATCGAAAAAGAACCT
  • lacZ fusion

  • pGP248 (in [SW|pAC5]), available in [SW|Jörg Stülke]'s lab
  • References

  • 18083814,12618455,12670965,15060025,12107147,21699902,24163341,19923721