SubtiBank SubtiBank
cotB [2020-06-29 10:01:38]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotB [2020-06-29 10:01:38]

spore coat protein (outer)
42.81 kDa
protein length
380 aa Sequence Blast
gene length
1143 bp Sequence Blast
resistance of the spore
spore coat protein (outer)

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class V]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    3,714,739 3,715,881

    The protein


  • phosphorylated on serine residues by [protein|D53067098F693669F61E5CCF6C06664580C40C79|CotH] [Pubmed|27185916]
  • maturation of CotB requires [protein|49BAFE3E69F1F91AEF4154F55B44639DD3CE4A71|CotG] [Pubmed|26953338]
  • [SW|Localization]

  • outer spore coat, at the middle of the spore as a ring- or spiral-like structure, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814,19933362]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,8755863,1691789,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|20435725], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15470121], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|26577401], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE], [SW|SpoIIID]) [Pubmed|26577401,15699190,8755863,15470121]
  • view in new tab



  • expressed late during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE], [protein|search|GerR]) [Pubmed|15699190,1691789,15383836,20435725]
  • view in new tab

    Biological materials


  • 1S102 ( ''cotB''::''cat''), [Pubmed|2821284], available at [ BGSC]
  • BKE36050 ([gene|2A0B2CA7C982C03C1AFBDB3540A918EE937B06CB|cotB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAATTCCTCCTAGTC, downstream forward: _UP4_TAATAGATAATGGAGGAGCA
  • BKK36050 ([gene|2A0B2CA7C982C03C1AFBDB3540A918EE937B06CB|cotB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAATTCCTCCTAGTC, downstream forward: _UP4_TAATAGATAATGGAGGAGCA
  • References

  • 22171814,19933362,1518043,2821284,14762006,1691789,19933362,15699190,20435725,15383836,25259857,26953338,27185916