SubtiBank SubtiBank
cotB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cotB

spore coat protein (outer)
locus
BSU36050
pI
9.83
mw
42.81 kDa
protein length
380 aa Sequence Blast
gene length
1143 bp Sequence Blast
function
resistance of the spore
product
spore coat protein (outer)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,714,739 3,715,881

    The protein

    Modification

  • phosphorylated on serine residues by [protein|D53067098F693669F61E5CCF6C06664580C40C79|CotH] [Pubmed|27185916]
  • maturation of CotB requires [protein|49BAFE3E69F1F91AEF4154F55B44639DD3CE4A71|CotG] [Pubmed|26953338]
  • [SW|Localization]

  • outer spore coat, at the middle of the spore as a ring- or spiral-like structure, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814,19933362]
  • Expression and Regulation

    Operons

    genes
    [gene|D53067098F693669F61E5CCF6C06664580C40C79|cotH]-[gene|2A0B2CA7C982C03C1AFBDB3540A918EE937B06CB|cotB]-[gene|61004D2C1EDA3CD84514FD6D468BF594575616F4|ywrJ]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,8755863,1691789,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|20435725], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15470121], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|26577401], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE], [SW|SpoIIID]) [Pubmed|26577401,15699190,8755863,15470121]
  • view in new tab

    genes
    [gene|2A0B2CA7C982C03C1AFBDB3540A918EE937B06CB|cotB]-[gene|61004D2C1EDA3CD84514FD6D468BF594575616F4|ywrJ]
    description
    [Pubmed|22383849]

    regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE], [protein|search|GerR]) [Pubmed|15699190,1691789,15383836,20435725]
  • view in new tab

    Biological materials

    Mutant

  • 1S102 ( ''cotB''::''cat''), [Pubmed|2821284], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S102&Search=1S102 BGSC]
  • BKE36050 ([gene|2A0B2CA7C982C03C1AFBDB3540A918EE937B06CB|cotB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAATTCCTCCTAGTC, downstream forward: _UP4_TAATAGATAATGGAGGAGCA
  • BKK36050 ([gene|2A0B2CA7C982C03C1AFBDB3540A918EE937B06CB|cotB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAATTCCTCCTAGTC, downstream forward: _UP4_TAATAGATAATGGAGGAGCA
  • References

  • 22171814,19933362,1518043,2821284,14762006,1691789,19933362,15699190,20435725,15383836,25259857,26953338,27185916