SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


adenylsuccinate lyase
49.32 kDa
protein length
431 aa Sequence Blast
gene length
1296 bp Sequence Blast
purine biosynthesis
adenylsuccinate lyase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • Gene

    700,232 701,527

    Phenotypes of a mutant

  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • N6-(1,2-dicarboxyethyl)-AMP --> AMP + fumarate (according to UniProt)
  • (2S)-2-[5-amino-1-(5-phospho-β-D-ribosyl)imidazole-4-carboxamido]succinate --> 5-amino-1-(5-phospho-β-D-ribosyl)imidazole-4-carboxamide + fumarate (according to UniProt)
  • Protein family

  • [SW|lyase 1 family] (according to UniProt)
  • Structure

  • [PDB|1F1O]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • BKE06440 ([gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAGGTCTTGAATAACGTT, downstream forward: _UP4_TAGAAGAAGCTTTTAGCGGC
  • BKK06440 ([gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAGGTCTTGAATAACGTT, downstream forward: _UP4_TAGAAGAAGCTTTTAGCGGC
  • References

  • 1722815,3036807,12923093,15378759,7638212,28189581