SubtiBank SubtiBank
yitU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yitU

dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate (minor activity)
locus
BSU_11140
pI
4.67
mw
30.48 kDa
protein length
270 aa Sequence Blast
gene length
813 bp Sequence Blast
function
dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate (minor activity)
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.2|Biosynthesis/ acquisition of riboflavin/ FAD]
  • Gene

    Coordinates
    1,190,490 1,191,302

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of the riboflavin precursor, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5'-phosphate (minor activity) [Pubmed|26316208]
  • 5-amino-6-(5-phospho-D-ribitylamino)uracil + H2O --> 5-amino-6-(D-ribitylamino)uracil + phosphate (according to UniProt)
  • Protein family

  • [SW|HAD superfamily] (according to UniProt) [Pubmed|26316208]
  • [SW|Cof family] (according to UniProt)
  • Structure

  • [PDB|1RKQ] (YidA from E. coli, 31% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|29EFA7585D7B2FD3A2CDBE2F21AB6742980759B4|yitU]-[gene|8A1EEBB7F3CA4ADE6C1D9ADACFC00DCEF29C3304|yizC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [pubmed|30782632], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B185 (yitU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1184 NBRP B. subtilis, Japan]
  • BKE11140 ([gene|29EFA7585D7B2FD3A2CDBE2F21AB6742980759B4|yitU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAAGCTCCTTTAACC, downstream forward: _UP4_TAAAGAAGGTCCGTATTAAT
  • BKK11140 ([gene|29EFA7585D7B2FD3A2CDBE2F21AB6742980759B4|yitU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAAGCTCCTTTAACC, downstream forward: _UP4_TAAAGAAGGTCCGTATTAAT
  • References

  • 26316208