SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[category|SW 4.2|Sporulation] initiation phosphotransferase of the [SW|phosphorelay]
22.40 kDa
protein length
192 aa Sequence Blast
gene length
579 bp Sequence Blast
initiation of [SW|sporulation]
[SW|sporulation ]initiation phosphotransferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|The phosphotransferases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|The phosphotransferases]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    2,853,981 2,854,559

    Phenotypes of a mutant

  • Arrest of [SW|sporulation ]at stage 0 (initiation) [pubmed|4633157]
  • The protein


  • [PDB|1F51] (complex with [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F])
  • [PDB|1IXM]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2537815], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • expression is repressed by binding of [SW|RpoE] to the A-rich sequence in the -35 region of the promoter [Pubmed|27679485]
  • view in new tab

    Biological materials


  • [ spo0B12], point mutation 85C>T (=R29W), available in [ BGSC] 1S54
  • [ spo0B136], amber mutation 103A>T (=K35X), available in [ BGSC] 1S16
  • [ spo0B580ts], point mutation 193G>A (=E65K), available in [ BGSC] 1S90
  • [ spo0B581ts], point mutation 461G>A (=G154D), available in [ BGSC] 1S91
  • BKE27930 ([gene|29D91115BB3AC03538D618E54A5A57F92777EFF6|spo0B]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCGCACTCCCAATCA, downstream forward: _UP4_TAGCGGAGTTTTTAACGGTT
  • BKK27930 ([gene|29D91115BB3AC03538D618E54A5A57F92777EFF6|spo0B]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCGCACTCCCAATCA, downstream forward: _UP4_TAGCGGAGTTTTTAACGGTT
  • References


  • 28886686
  • Original Publications

  • 20413551,12730135,2437099,9141138,3918016,9299348,16788205,12067336,9726997,2118512,10997904,1846779,9477965,2537815,23490197,27501195,30212463