SubtiBank SubtiBank
ptsH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ptsH

HPr, General component of the sugar [SW|phosphotransferase system] (PTS)
locus
BSU_13900
pI
4.58
mw
9.05 kDa
protein length
gene length
267 bp Sequence Blast
function
PTS-dependent sugar transport and carbon catabolite repression
product
histidine-containing phosphocarrier protein HPr of the PTS
essential
no
ec
2.7.11.-
synonyms
HPr

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.1|General PTS proteins]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    1,459,384 1,459,650

    The protein

    Protein family

  • HPr family (with [protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh], according to UniProt)
  • Paralogous protein(s)

  • [protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh]
  • [SW|Domains]

  • HPr domain (aa 2-88) (according to UniProt)
  • Modification

  • transient phosphorylation by [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|Enzyme I] of the PTS on His-15
  • regulatory phosphorylation on Ser-46 by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK] [Pubmed|2507315]
  • an extensive study on ''in vivo'' HPr phosphorylation can be found in Singh et al. (2008) [PubMed|18757537]
  • weak phosphorylation on Ser-12 [Pubmed|17218307]
  • ''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] on Ser-12 [Pubmed|20389117]
  • Structure

  • [PDB|2HID] (NMR) [Pubmed|9336834]
  • [PDB|1KKM] (complex of ''L. casei'' [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK] with ''B. subtilis'' HPr-Ser-P)
  • [PDB|1KKL] (complex of ''Lactobacillus casei'' [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK] with ''B. subtilis'' HPr)
  • [PDB|3OQM] (complex of ''B. subtilis'' [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and the [gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA] operator site)
  • [PDB|3OQN] (complex of ''B. subtilis'' [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and the [gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR] operator site)
  • [PDB|3OQO] (complex of ''B. subtilis'' [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and a optimal synthetic operator site)
  • [SW|Localization]

  • cytoplasm [Pubmed|23475962]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]
    description
    [Pubmed|11902727]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    genes
    [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]
    description
    [Pubmed|11902727]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]-dependent [SW|RNA switch] [PubMed|9765562], in [regulon|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT regulon]
  • regulation

  • expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • available in [SW|Jörg Stülke]'s lab:
  • MZ303 (cat)
  • GP507 [gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]1 (S46A)
  • GP506 ([gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-H15A)
  • GP778 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928]
  • BKE13900 (Δ[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • BKK13900 (Δ[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • GFP fusion

  • GP1267, [gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-cfp, available in [SW|Jörg Stülke]'s lab [pubmed|23475962]
  • Expression vectors

  • pGP438 (with N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pAG2 (His-tag) [Pubmed|9237995], available in [SW|Anne Galinier] lab
  • pGP371(expression / purification of HPr-S46A, with His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP1415 (HPr, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • pGP961 (HPr, expression in ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • pGP1416 (HPr-H15A, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • pGP2431 (N-terminal Strep-tag, expression and purification from ''B. subtilis'', in [SW|pGP380]), for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • [SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
  • [SW|Boris Görke], Max Perutz Center, Vienna, Austria
  • [SW|Anne Galinier], University of Marseille, France
  • References

  • 16519689,12850135,17218307,16519689,17142398,12359875,1577686,9162046,11929549,9336834,7803390,7623661,2846556,8169206,9973552,15126459,10048041,12169607,9622354,10217795,17693724,18757537,9202047,7592487,15369672,14527945,2507315,8580838,19651770,8418852,26282429,1303754,1549615,20081037,20389117,20444094,22001508,22722928,23551403,15378759,26381121,9336834,23475962