SubtiBank SubtiBank
sdpR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

sdpR

transcriptional repressor ([SW|ArsR family]) of the [gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]-[gene|search|sdpI ]operon
locus
BSU_33790
pI
7.33
mw
10.10 kDa
protein length
gene length
273 bp Sequence Blast
function
regulation of protection against [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC]
product
transcriptional regulator ([SW|ArsR family])
essential
no
synonyms
yvbA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • Gene

    Coordinates
    3,467,054 3,467,326

    The protein

    Protein family

  • [SW|ArsR family]
  • [SW|Domains]

  • [SW|HTH arsR-type domain] (aa 1-87) (according to UniProt)
  • Effectors of protein activity

  • [protein|3FB5839A7A80CF52E627FF1744E50490F5CC390F|SdpI] binds and sequesters [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR] if extracellular [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC] is present, this results in induction of the ''[gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]-[gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]'' operon [Pubmed|16469701]
  • Structure

  • [PDB|2CWE] (from Pyrococcus horikoshii, 34% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000211 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]-[gene|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI]
    description
    [Pubmed|12817086]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16469701], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|16469701], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR]: repression, [Pubmed|16469701], in [regulon|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR regulon]
  • regulation

  • induced by extracellular [protein|search|SdpC] ([protein|search|SdpR]) [Pubmed|16469701]
  • view in new tab

    Biological materials

    Mutant

  • BKE33790 ([gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCGTTTTCTCCTTTAC, downstream forward: _UP4_TTATGAAGAAAAATATAATT
  • BKK33790 ([gene|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCGTTTTCTCCTTTAC, downstream forward: _UP4_TTATGAAGAAAAATATAATT
  • References

    Reviews

  • 20955377
  • Original Publications

  • 12817086,16469701,10960106