SubtiBank SubtiBank
yqbM [2018-08-23 14:26:47]
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website

yqbM [2018-08-23 14:26:47]

similar to phage-related protein
locus
BSU26060
pI
4.57
mw
16.16 kDa
protein length
147 aa Sequence Blast
gene length
441 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,679,142 → 2,679,585

    The protein

    [SW|Localization]

  • membrane (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE26060 (Δ[gene|298588F646B7271A91DAEEE60967AA4C134A8082|yqbM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTGCGCTTTTAATGCCA, downstream forward: _UP4_TAATCACTTTCACGAAAAAT
  • BKK26060 (Δ[gene|298588F646B7271A91DAEEE60967AA4C134A8082|yqbM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTGCGCTTTTAATGCCA, downstream forward: _UP4_TAATCACTTTCACGAAAAAT