SubtiBank SubtiBank
yqbM
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqbM

similar to phage-related R-Type bacteriocin tube protein
locus
BSU_26060
pI
4.57
mw
16.16 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,679,142 2,679,585

    The protein

    Paralogous protein(s)

  • [protein|683D350D98AC0D27951145AD87830B89C0B4F393|XkdM]: 95% identity
  • Structure

  • [PDB|2GUJ] ([protein|683D350D98AC0D27951145AD87830B89C0B4F393|XkdM], 95% identity)
  • Biological materials

    Mutant

  • BKE26060 ([gene|298588F646B7271A91DAEEE60967AA4C134A8082|yqbM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTGCGCTTTTAATGCCA, downstream forward: _UP4_TAATCACTTTCACGAAAAAT
  • BKK26060 ([gene|298588F646B7271A91DAEEE60967AA4C134A8082|yqbM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTGCGCTTTTAATGCCA, downstream forward: _UP4_TAATCACTTTCACGAAAAAT
  • References

    Research papers

  • 30127773