SubtiBank SubtiBank
yqbM
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqbM

similar to phage-related R-Type bacteriocin tube protein
locus
BSU_26060
pI
4.57
mw
16.16 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,679,142 2,679,585

    The protein

    Paralogous protein(s)

  • [protein|683D350D98AC0D27951145AD87830B89C0B4F393|XkdM]: 95% identity
  • Structure

  • [PDB|2GUJ] ([protein|683D350D98AC0D27951145AD87830B89C0B4F393|XkdM], 95% identity)
  • Biological materials

    Mutant

  • BKE26060 ([gene|298588F646B7271A91DAEEE60967AA4C134A8082|yqbM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTGCGCTTTTAATGCCA, downstream forward: _UP4_TAATCACTTTCACGAAAAAT
  • BKK26060 ([gene|298588F646B7271A91DAEEE60967AA4C134A8082|yqbM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTGCGCTTTTAATGCCA, downstream forward: _UP4_TAATCACTTTCACGAAAAAT
  • References

    Research papers

  • 30127773