SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


AAA unfoldase, ATP-dependent Clp protease, ATP-binding subunit (class III heat-shock protein)
46.25 kDa
protein length
420 aa Sequence Blast
gene length
1263 bp Sequence Blast
protein degradation
AAA unfoldase, ATP-dependent Clp protease, ATP-binding subunit

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • Gene

    2,884,781 2,886,043

    Phenotypes of a mutant

  • increased thermotolerance due to increased stabiliy of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] and thus increased expression of ''[gene|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|trxA]'' [Pubmed|24417481]
  • the mutation suppresses the heat sensitivity of spores overexpressing ''[gene|85DE3CB6CDA61C141C6030367C0A13BB642160B9|cmpA]'' [Pubmed|26387458]
  • The protein

    Catalyzed reaction/ biological activity

  • ATPase/chaperone
  • Protein family

  • ClpX chaperone family (with [protein|2A5A080273CB7698DFABB147F4143E90BBCA3B01|ClpY], according to UniProt)
  • [SW|Domains]

  • AAA-ATPase [ PFAM]
  • Zinc finger [ PFAM]
  • Structure

  • [PDB|1UM8] (from ''Helicobacter pylori'') [Pubmed|14514695]
  • [SW|Localization]

  • cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heat shock, colocalization with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [Pubmed|18786145,18689473]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8973311], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [Pubmed|9852015], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • induced by heat stress ([protein|search|CtsR]) [Pubmed|9852015]
  • view in new tab

    Biological materials


  • MGNA-B019 (clpX::erm), available at the [ NBRP B. subtilis, Japan]
  • GPUG2 (aphA3), available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs
  • GP1787 (aphA3), available in [SW|Jörg Stülke]'s lab
  • ''clpX::kan'', ''clpX::spec'' and ''clpX::cat'' available from the [ Hamoen]] Lab
  • BKE28220 ([gene|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCACCCCTTAATC, downstream forward: _UP4_TAAAGATAAGCACAAACCTC
  • BKK28220 ([gene|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCACCCCTTAATC, downstream forward: _UP4_TAAAGATAAGCACAAACCTC
  • GFP fusion

  • C-terminal GFP fusions (both single copy and 2th copy in ''amyE'' locus, also as CFP and YFP variants) available from the [ Hamoen]] Lab
  • labs

  • [SW|Leendert Hamoen], Newcastle University, UK [ homepage]
  • References


  • 23375660,19680248,17302811,23479438,19609260,26639779,28748186
  • Original Publications

  • 12761164,10809708,9643546,11807061,14679237,18689476,16899079,8973311,19136590,11325926,8973311,9852015,18689473,20525796,15948963,18786145,24417481,24942655,25433860,25866879,14514695,26387458,27669037,29625553