SubtiBank SubtiBank
alkA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

alkA

DNA-3-methyladenine glycosylase
locus
BSU_01800
pI
8.15
mw
35.48 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
function
adaptive response to alkylative DNA damage
product
DNA-3-methyladenine glycosylase
essential
no
ec
3.2.2.21
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • Gene

    Coordinates
    202,547 203,458

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of alkylated DNA, releasing 3-methyladenine, 3-methylguanine, 7-methylguanine and 7-methyladenine (according to UniProt)
  • Protein family

  • alkylbase DNA glycosidase AlkA family (with [protein|82CDC97D16426016CA7E75240C1A6D0D600F4375|YfjP], according to UniProt)
  • Structure

  • [PDB|2JHJ] (from Archaeoglobus fulgidus, 29% identity) [pubmed|17396151]
  • Expression and Regulation

    Operons

    genes
    [gene|297DF91EF3E91A6D2DC39BBC7FE8711AB7EBE509|alkA]
    description
    [Pubmed|8376346]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8376346], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|0F8A564256A598DB3A36668FA0C984542FE1323F|AdaA]: positive regulation, in [regulon|0F8A564256A598DB3A36668FA0C984542FE1323F|AdaA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE01800 ([gene|297DF91EF3E91A6D2DC39BBC7FE8711AB7EBE509|alkA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTCATTCTCCTTAT, downstream forward: _UP4_TGAATCATTTCAACTTTAAC
  • BKK01800 ([gene|297DF91EF3E91A6D2DC39BBC7FE8711AB7EBE509|alkA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTCATTCTCCTTAT, downstream forward: _UP4_TGAATCATTTCAACTTTAAC
  • References

    Reviews

  • 22933559,24810496
  • Original publications

  • 8376346,17396151