SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


23.17 kDa
protein length
215 aa Sequence Blast
gene length
648 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    408,240 408,887

    The protein

    Paralogous protein(s)

  • [protein|199FA65621C241CB27BBC382A4C62A34DCC74570|YyaS]
  • Expression and Regulation


    (according to [ DBTBS]) null
    view in new tab

    Biological materials


  • BKE03580 ([gene|294A73C15606178860DC2509B322519B2B010ABD|yczE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGAGGTCCCTTCTTTC, downstream forward: _UP4_TAAAACAAAGCCGCCTTGGC
  • BKK03580 ([gene|294A73C15606178860DC2509B322519B2B010ABD|yczE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGAGGTCCCTTCTTTC, downstream forward: _UP4_TAAAACAAAGCCGCCTTGGC