SubtiBank SubtiBank
yczE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yczE

unknown
locus
BSU_03580
pI
10.02
mw
23.17 kDa
protein length
215 aa Sequence Blast
gene length
648 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    408,240 408,887

    The protein

    Paralogous protein(s)

  • [protein|199FA65621C241CB27BBC382A4C62A34DCC74570|YyaS]
  • Expression and Regulation

    Operons

    genes
    [gene|294A73C15606178860DC2509B322519B2B010ABD|yczE]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yczE.html DBTBS]) null
    view in new tab

    Biological materials

    Mutant

  • BKE03580 ([gene|294A73C15606178860DC2509B322519B2B010ABD|yczE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGAGGTCCCTTCTTTC, downstream forward: _UP4_TAAAACAAAGCCGCCTTGGC
  • BKK03580 ([gene|294A73C15606178860DC2509B322519B2B010ABD|yczE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGAGGTCCCTTCTTTC, downstream forward: _UP4_TAAAACAAAGCCGCCTTGGC