SubtiBank SubtiBank
ydaG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydaG

putative pyridoxamine 5'-phosphate oxidase , general stress protein, required for protection against paraquat stress
locus
BSU04220
pI
5.20
mw
15.00 kDa
protein length
140 aa Sequence Blast
gene length
423 bp Sequence Blast
function
survival of stress conditions
product
putative pyridoxamine 5'-phosphate oxidase
essential
no
synonyms
yzzA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    473,803 474,225

    The protein

    Structure

  • [PDB|3DB0] (from Listeria innocua, 43% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
    description
    [Pubmed|10220166]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10220166], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced under stress conditions ([protein|search|SigB]) [Pubmed|10220166]
  • view in new tab

    genes
    [gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]-[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]-[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
    description
    [Pubmed|10220166]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,10220166], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C102 (ydaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2100 NBRP B. subtilis, Japan]
  • BKE04220 ([gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCGAATCACTCCTTTT, downstream forward: _UP4_TAAAAAATTTGTGTTTTCAG
  • BKK04220 ([gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCGAATCACTCCTTTT, downstream forward: _UP4_TAAAAAATTTGTGTTTTCAG
  • References

  • 10220166,22582280,15805528,23033921