SubtiBank SubtiBank
ydaG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydaG

putative pyridoxamine 5'-phosphate oxidase , general stress protein, required for protection against paraquat stress
locus
BSU_04220
pI
5.20
mw
15.00 kDa
protein length
140 aa Sequence Blast
gene length
423 bp Sequence Blast
function
survival of stress conditions
product
putative pyridoxamine 5'-phosphate oxidase
essential
no
synonyms
yzzA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    473,803 474,225

    The protein

    Structure

  • [PDB|3DB0] (from Listeria innocua, 43% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
    description
    [Pubmed|10220166]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10220166], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced under stress conditions ([protein|search|SigB]) [Pubmed|10220166]
  • view in new tab

    genes
    [gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]-[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]-[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
    description
    [Pubmed|10220166]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,10220166], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C102 (ydaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2100 NBRP B. subtilis, Japan]
  • BKE04220 ([gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCGAATCACTCCTTTT, downstream forward: _UP4_TAAAAAATTTGTGTTTTCAG
  • BKK04220 ([gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCGAATCACTCCTTTT, downstream forward: _UP4_TAAAAAATTTGTGTTTTCAG
  • References

  • 10220166,22582280,15805528,23033921