SubtiBank SubtiBank
lytD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lytD

peptidoglycan N-acetylglucosaminidase
locus
BSU_35780
pI
9.94
mw
95.36 kDa
protein length
880 aa Sequence Blast
gene length
2643 bp Sequence Blast
function
major autolysin, cell separation
product
peptidoglycan N-acetylglucosaminidase
essential
no
ec
3.2.1.96
synonyms
cwlG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.5|N-acetyl-β-D-glucosaminidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,684,826 3,687,468

    The protein

    Catalyzed reaction/ biological activity

  • hydrolysis of the glycosidic bond between N-acetyl--d-glucosamine residues and adjacent monosaccharides [Pubmed|18266855]
  • Endohydrolysis of the N,N'-diacetylchitobiosyl unit in high-mannose glycopeptides and glycoproteins containing the -(Man(GlcNAc)(2))Asn-structure. One N-acetyl-D-glucosamine residue remains attached to the protein, the rest of the oligosaccharide is released intact (according to UniProt)
  • Protein family

  • glycosyl hydrolase 73 family (with [protein|AF0BC3D534BC2CCCAAB53B286CF4286E58A8A338|LytG], according to UniProt)
  • [SW|Domains]

  • SPOR 1 domain (aa 70-149) (according to UniProt)
  • SPOR 2 domain (aa 150-229) (according to UniProt)
  • SPOR 3 domain (aa 230-311) (according to UniProt)
  • [SW|SH3B domain] (aa 630-700) (according to UniProt)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|29219315D31BA4ADE41687EFF17FE41D6C23D157|lytD]
    description
    [Pubmed|7934877]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|7934877], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • 1A788 ( ''lytD''::''tet''), [Pubmed|7934877], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A788&Search=1A788 BGSC]
  • 1A792 ( ''lytD''::''tet''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A792&Search=1A792 BGSC]
  • BKE35780 ([gene|29219315D31BA4ADE41687EFF17FE41D6C23D157|lytD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCTCCTCTTTCTT, downstream forward: _UP4_TAAAAAACTTAGAAAGTTGC
  • BKK35780 ([gene|29219315D31BA4ADE41687EFF17FE41D6C23D157|lytD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTTCTCCTCTTTCTT, downstream forward: _UP4_TAAAAAACTTAGAAAGTTGC
  • References

    Reviews

  • 18266855
  • Original publications

  • 7934877,19542270,18957862,21821766