SubtiBank SubtiBank
thrB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thrB

homoserine kinase
locus
BSU32240
pI
4.74
mw
33.17 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast
function
biosynthesis of threonine
product
homoserine kinase
essential
no
ec
2.7.1.39
synonyms
thrA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • Gene

    Coordinates
    3,312,844 3,313,773

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-homoserine = ADP + O-phospho-L-homoserine (according to Swiss-Prot)
  • Protein family

  • GHMP kinase family (together with [protein|36930CC6FDFCA23D43E264FEA375B78A1434E1BD|GalK] and [protein|8FA635D1915108BF29A864AF4DA28ECF633F735F|IspE]) (according to UniProt)
  • Structure

  • [PDB|3HUL] (from ''Listeria monocytogenes'', 41% identity, 61% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|0F40291BB10DB6D7DFD94B9C7D700F4410C4EE69|yutH]-[gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    genes
    [gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24163341], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR]: repression, [Pubmed|27260660], in [regulon|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR regulon]
  • regulation

  • expressed in the presence of lysine or cysteine ([SW|ThrR]) [Pubmed|27260660]
  • view in new tab

    Biological materials

    Mutant

  • BKE32240 ([gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGAGAACAGCATGTCGGCTT, downstream forward: _UP4_TAGATCATGCCAAGCGTTCC
  • BKK32240 ([gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGAGAACAGCATGTCGGCTT, downstream forward: _UP4_TAGATCATGCCAAGCGTTCC
  • References

  • 12107147,3098560,24163341,27260660