SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


homoserine kinase
33.17 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast
biosynthesis of threonine
homoserine kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of lysine/ threonine]
  • Gene

    3,312,844 3,313,773

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-homoserine --> ADP + H+ + O-phospho-L-homoserine (according to UniProt)
  • Protein family

  • GHMP kinase family (together with [protein|36930CC6FDFCA23D43E264FEA375B78A1434E1BD|GalK] and [protein|8FA635D1915108BF29A864AF4DA28ECF633F735F|IspE]) (according to UniProt)
  • Structure

  • [PDB|3HUL] (from ''Listeria monocytogenes'', 41% identity, 61% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation




  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab


    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24163341], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR]: repression, [Pubmed|27260660], in [regulon|A4B7CF7A1C704C750AFAD97A43AF975260935083|ThrR regulon]
  • regulation

  • expressed in the presence of lysine or cysteine ([SW|ThrR]) [Pubmed|27260660]
  • view in new tab

    Biological materials


  • BKE32240 ([gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGAGAACAGCATGTCGGCTT, downstream forward: _UP4_TAGATCATGCCAAGCGTTCC
  • BKK32240 ([gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGAGAACAGCATGTCGGCTT, downstream forward: _UP4_TAGATCATGCCAAGCGTTCC
  • References

  • 12107147,3098560,24163341,27260660