SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional activator of the [gene|8A83E44AFE9A1A635C65E6B526690AF7DA201BE1|bsdB]-[gene|FD23F4C2AFCBFE35A79116C5A707FACD454E4180|bsdC]-[gene|868DC9DE1C9C26C780F4CEAA4185640B5B6B781B|bsdD] operon
32.83 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
regulation of resistance to salicylic acid
transcriptional activator ([SW|LysR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    411,578 412,450

    The protein

    Catalyzed reaction/ biological activity

  • transcriptional activation of the ''[gene|8A83E44AFE9A1A635C65E6B526690AF7DA201BE1|bsdB]-[gene|FD23F4C2AFCBFE35A79116C5A707FACD454E4180|bsdC]-[gene|868DC9DE1C9C26C780F4CEAA4185640B5B6B781B|bsdD]'' operon in response to salicylic acid
  • Protein family

  • [SW|LysR family] (according to UniProt)
  • [SW|Domains]

  • [SW|HTH lysR-type domain] (aa 1-59) (according to UniProt)
  • Structure

  • [PDB|2H99] (from Acinetobacter baylyi, 29% identity) [pubmed|19400783]
  • Biological materials


  • MGNA-C060 (yclA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03620 ([gene|28D03575FA24525C162E6C161631034568E89622|bsdA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAAAGCGCCTCCTTA, downstream forward: _UP4_TAAAAGATTTTGTCTTATGA
  • BKK03620 ([gene|28D03575FA24525C162E6C161631034568E89622|bsdA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAAAGCGCCTCCTTA, downstream forward: _UP4_TAAAAGATTTTGTCTTATGA
  • References

  • 17295427,19400783